Gene Expression Study Of Hypoxic Preconditioning On Human Endothelial Cells To Identify Responsible Genes

Background and objectives:The morbidity and mortality of ischemic heart disease,especially myocardial infarction,in the world is higher at present not only in developed countries but also in developing counties.Percutaneous coronary intervention and thrombolytic therapy is widely used to limit infarct size by early reopening of occluded coronary artery and restoration of blood flow to ischemic tissue.It is currently clear that reperfusion of blood flow itself can result in even worsening of ischemic myocardium,known as ischemia/reperfusion injury(IR).Until now there is no directly and effectively therapeutic strategy for protecting myocardium against injury of ischemia and ischemia/reperfusion. Fortunately and with increasing investigation,ischemic preconditioning (IPC) is suggested to be potential approach in preventing cardiomyocytes from ischemia and IR damage.IPC,first found in heart,is an endogenously protective phenomenon defined as one or several episodes of short ischemia followed by reperfusion,generates profound protection against a subsequent sublethal ischemia.This protective phenomenon was discovered and confirmed to work perfectly in vascular endothelial cells(ECs) too.The endothelial cell is not only an important barrier due to its special anatomic location at the surface between blood and tissue,which prevent solid cells such as cardiomyocytes beneath endothelium from infestation of harmful factors,but also active secretary tissue,which can secret various of bioactive substances to regulate the supply of oxygen and nutritive materials and maintain physiological function of tissues and organs.In the previous research,it was reported that structural and functional damage of ECs caused secondary injury of solid cells and was prior to cardiomyocytes during IR injury occurring.ECs apoptosis induced by ischemia and hypoxia was observed in vivo to be preceding cardiomyocytes,too.But convalescence of attenuated function and damaged structure of ECs is earlier than of cardiomyocytes.Those researches suggested that healthy and intact ECs may prevent or palliate the ischemia and IR injury to cardiomyocytes.Therefore,the study of IPC on ECs to prevent against ischemia and IR injury is great beneficial in theory and clinical practice for protection myocardium against ischemic damage.Up to now,the understanding of IPC mechanism is not completely clear.First,IPC phenomenon refers to complicated pathophysiological and genetic responses.Many reports about IPC research focused on one or few of genes,however,IPC mechanisms involve in being systemic responses of endogenous protection to ischemia and IR injury and all genes which contribute to this naturally protective phenomenon.All of involved genes decided together and finally protective efficacy of IPC, but not several genes alone.Next,HIF-1a gene plays a key role in hypoxic regulation and is viewed as a critical regulator of transcriptive activity of genes responded to hypoxia.It was observed that tissues and cells were effectively prevented from ischemia and IR injury by elevating HIF-1a expression.But it is unknown whether IPC phenomenon is influenced by silencing expression of HIF-1a gene.According to above considerations,HUVECs model of hypoxic preconditioning(HPC) in vitro,which mimic IPC phenomenon in vivo,would be established, then our study would detect systemic changes of gene induced by HPC and to evaluate protective efficiency of HPC on HUVECs after silencing HIF-1a expression or not.The study is proposed to provide theoretic bases for potentially clinical application of HPC in the future.Methods:1.HUVECs were cultured and verified by monoclonal antibody against factorⅧrelative antigen labeled with FITC.2.Model Establishment of HPC and hypoxia/reoxygenation(HR) injuey:HPC protocol was consisted of hypoxia for 1 hour plus reoxygenation for 1 hour.HR was consisted of hypoxia for 6 hour followed by reoxygenaration for 1 hour.Various cycles of HPC were tested by using MTT and LDH assay on HUVECs.3.Total RNA and protein were extracted and purified with TRIzol kit from HUVECs with or without treatment of HPC.RNA yield was quantified by spectrophotometrically and quality assessed by agarose gel electrophoresis.4.Gene expression was detected with cDNA microarray containing 21329 human genes on HUVECs with or without treatment of HPC. GenePixPro software 5.1,Genesifter and Gene Ontology were employed to analyze the microarray data.The results from microarray analysis were confirmed with Fluorescence real-time PCR.5.Preparation of HIF-1a special siRNA:siRNA sequence targeting HIF-1a gene is following:AAGGGTAAAGAACAAAACACA, Synthesized by Ambion Company.Transfecting condition was optimized first.Suitable concentration and transfecting percentage and inhibitory ratio were tested.6.Proper concentration of HIF-1a special siRNA was transfected into HUVECs with or without treatment of HPC.HIF-1a expression was assessed by capillary fluorescence real-time PCR and western blot at level of mRNA and protein,respectively.HPC protection was evaluated by assessment of LDH and caspase-3 level and apoptosis cells labeled with Annexin V-Cy3 under fluorescent microscopy.7.Statistic analysis:the data were presented as mean±SD,and statistical analysis was carried out with one-way ANOVA in SPSS software version 17.0.First,test of homogeneity of variances was done with Levene analysis,if the test results repealed homoscedasticity,the following statistical analysis was proceeded with ANOVA and correlative LSD method of multiple comparisons;but if the results repealed heterogeneity of variance,Welch analysis of approximative F test and correlative Dunnett’s 3 method of multiple comparisons were employed to test for statistical significances.Two samples t test was used for statistical analysis of two samples means,α=0.05 was viewed as criteria of significance. Results:1.1～3 cycles of HPC protocol consisted of hypoxia for 1h plus reoxygenation for 1h revealed HPC protection against hypoxia and HR injury.Comparison among varied cycles of HPC protocol,one cycle of HPC protocol was found to be better than others in protective effecay.2.A total of 809 genes,which were at least 2-fold change in ratio and statistically significant(P＜0.05,ANOVA analysis),were identified to differentially respond to HPC at five time points including hypoxia and HPC compared with normaxic control.At each one of 5 time points including H1h,HPC2h,HPC5h,HPC12h,and HPC24h,there were 460 (268 down-regulated and 193 up-regulated),406(245 down-regulated and 162 up-regulated),322(224 down-regulated and 98 up regulated), 350(266 down-regulated and 84 up-regulated) and 183(132 down-regulated and 51 up-regulated) genes with differential expression, respectively.At each time point,new emerged genes with differential expression were 460,191,53,48,and 88,respectively.3.Separate analysis of up-regulated or down-regulated or new emerged genes at each time point with differential expression(at least 2-fold change in ration,P＜0.05 ),there were pattern,which were composed of three segmentes,that were matched with early HPC, delayed HPC and middle periods between early and delayed HPC. Besides differential expression of 12 genes persisted through from the beginning to end point,the others lasted different periods.All 809 genes with differential expression belong to 23 kinds of biological functions. Suggesting that HPC phenomenon involved in complicated biological regulation with participation of different genes and multifunctional systems.4.mRNA level of 7 genes out of 809 genes with differential expression were determined with real-time PCR,the results revealed that expressive levels of 7 genes were coincident with results of microarray assessment.12 genes out of 809 genes with differential expression were verified previously to be relative to IPC protection.These verified genes included both harmful genes,which were down-regulated,and beneficial genes,which were up-regulate,during hypoxic preconditioning. Suggesting that HPC was dynamic balance of gene regulation between detrimental and helpful genes.And still there were masses of new genes involved in HPC whose functions would be investigated further.5.More LDH was delivered from HUVECs treated with HR injury after HIF-1a expression was silenced with siRNA,suggesting that siRNA silencing HIF-1a exacerbated the HR damage to HUVECs.Apoptosis of HUVECs treated with HR injury was no significant increase after HIF-1a expression was silenced with siRNA,suggesting that siRNA silencing HIF-1a did not enhance HUVECs apoptosis induced by HR damage.6.HUVECs were protected partially,but not completely by HPC after HIF-1a expression was silenced with siRNA,and indicating that HPC protection of HUVECs against HR injury was involved in activation of HIF-1a gene.Conclusions:1.HUVECs model of hypoxic preconditioning was established successfully.2.HUVECs were injured remarkably by HR,and HPC enhanced protective efficence of HUVECs against HR damage significantly.3.HPC protection of HUVECs involved in 809 genes and 23 biological functional systems,suggesting that HPC phenomenon involved in complicated biological regulation with participation of different genes and multifunctional systems.4.Up- and down-regulation of 12 genes,which were verified previously to be relative to IPC protection,suggested HPC phenomenon was dynamic balance of gene regulation between harmful and beneficial genes.The roles of masses of new discovered genes in HPC remained uncleared and would be studied further.5.Silencing HIF-1a expression exacerbated the HR damage to HUVECs,but not inducied more HUVECs apoptosis.6.HIF-1a gene was a key regulator involved in HPC protecting HUVECs against HR injury.7.HR damage of HUVECs was closely correlative with expression of HIF-1a gene.