Studies On The Role Of FKBP14 In Proliferation And Migration Of Epithelial Ovarian Cancer

Ovarian cancer is the most lethal form of gynecologic malignancy and characterized by a high rate of mortality among gynecologic oncology patients. Ovarian cancer is frequently diagnosed in advanced stage, contributing to a relatively high mortality and poor survival. The five-year survival rate is only 30%. The poor clinical outcome of ovarian cancer patients emphasize the requirement of developing better methods of diagnosis, treatment and prevention of this disease based on an in-depth understanding of molecular pathogenesis and progression of ovarian cancer.FKBP14 belongs to FK506-binding proteins (FKBPs), which are known as an intracellular receptor for immunosuppressive drugs FK506 and rapamycin. The mutations of FKBP14 cause a variant of Ehlers-Danlos syndrome. A recent study reported that FKBP14 regulated Presenilin protein levels and Notch signaling during the development of Drosophila. FKBPs often exhibit peptidyl-prolyl cis-trans isomerase (PPIase) activity. Recent reports have revealed the roles of FKBPs on gene expression, DNA repair, and DNA replication. FKBP12 is shown as a physiologic regulator of cell cycle and intracellular calcium homeostasis. FKBP38 is suggested as a negative regulator of cell apoptosis. Although few investigation have been carried out on the expression profile and biological functions of FKBP14 in human tumors, several members of FKBPs are reported to be involved in the development and progression of cancer. For instance, FKBP11 and FKBP52 was identified overexpressed in hepatocellular carcinoma. FKBP5 was overexpressed in, prostate cancer, melanoma and glioma. FKBP65 expression was decreased in high-grade ovarian serous carcinoma.In the present study, we determined the overexpression of FKBP14 in ovarian cancer tissues as compared with normal tissues. The effects of FKBP14 knockdown on the proliferation, cell cycle progression and apoptosis of ovarian cancer cells were then evaluated. We also tried to investigate the involved possible mechanism. Our study suggested that FKBP14 is a possible oncogene in ovarian cancer and may serve as an effective therapeutic target for this disease.Part Ⅰ:FKBP14 Expression in Epithelial Ovarian CancersObjective:By detecting the mRNA and protein expressions of FKBP14 in epithelial ovarian cancer tissues, to investigate the roles of FKBP14 in epithelial ovarian cancer.Methods:1. To assess the FKBP14 mRNA levels in 40 pairs of ovarian cancer tissues and non-cancerous tissues.2. To perform immunohistochemistry tissue array analyses of FKBP14 expression, using 60 epithelial ovarian cancer samples and 20 benign ovarian cyst samples.Results:1. FKBP14 mRNA expression was significantly elevated in ovarian cancer tissues compared with that in noncancerous tissues.2. Higher level of FKBP14 protein expression was observed in 51 epithelial ovarian cancer tissues, while lower level expression in other 9 cancer samples and 20 benign cyst tissues.Conclusions:FKBP14 expression was significantly elevated in epithelial ovarian cancer tissues, so we presumed that FKBP14 may act as an oncogenic factor in ovarian cancer development.Part Ⅱ:Effects of FKBP14 Knockdown on Proliferation, Apoptosis, Migration and Invasion of Ovarian Cancer CellsObjective:To investigate the effects of FKBP14-shRNA-mediated gene silencing on proliferation, apoptosis, migration and invasion of ovarian cancer cell lines SKOV3 and HO8910. To explore the role of FKBP14 in ovarian cancer cells in vitro, and to develop therapeutic potential of FKBP14 in ovarian cancer.Methods:1. Examined the FKBP14 mRNA and protein level of five ovarian cancer cell lines. Two cell lines, SKOV3 and HO8910, showed higher FKBP14 mRNA and protein expression.2. Lentiviral vector production:Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and non-silencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector.The constructs and lentiviral packaging vectors were then transfected into HEK293T cells via Lipofectamine 2000. After incubated for 48 h, lentivirus was collected from culture medium to infect target cells.3. Cell proliferation was monitored with Cell Counting Kit-8 (CCK-8), according to the manufacturer’s instructions.4. Annexin V-FITC/PI staining by flow cytometry analysis was used to detect the apoptosis of ovarian cancer cells infected with FKBP14 shRNA NC or WT.5. Transwell assay was employed to test ovarian cancer cell migration and invasion after FKBP14-shRNA was transfection.6. E-cadherin, Twistl, MMP2, BCL-2, BAX, capspase3, PCNA protein were detected by Real-time PCR and Western blot assay.7. Results of experiments are expressed as mean±SD. Statistical significance was determined using the Student’s t test. P< 0.05 was considered statistically significant.Results:1. FKBP14 protein level was reduced by about 90% in both cell lines infected with FKBP14 shRNA lentivirus (RNAi), as compared with cells infected with non-silencing shRNA lentivirus (NC). There was no difference between NC and non-treated cells (WT).2. No statistically significant differences in cell proliferation were observed between NC and WT cells, indicating that the lentiviral system had no cytotoxic effect on cells, whereas the proliferation was markedly inhibited by FKBP14 knockdown at 48 and 72 h in both SKOV3 and HO8910 cells.3. FKBP14 shRNA lentivirus infection significantly increased the percentage of cells in G0/G1 phase (P<0.001) and decrease the percentage of cells in S phase (P<0.01), as compared with the NC cells. FKBP14 knockdown resulted in a approximately 9-fold increase in the apoptotic ratio, as compared with the NC cells (P<0.001). No obvious difference cell cycle distribution and cell apoptotic ratio was found between NC and WT cells.4. FKBP14 knockdown resulted in a notable decrease of a marker of cell proliferation (PCNA) and anti-apoptosis protein (Bcl-2), and a significant increase of apoptosis marker (cleaved capspase3) and apoptosis promoting protein (Bax). The ratio of Bax/Bcl2 was significantly increased when FKBP14 expression was suppressed.5. Both tumor cell migration and invasion assays indicated that knockdown of FKBP14 could reduce the migration and invasion power of ovarian cancer cells.6. MMP2 and Twistl protein were decreased, while E-cadherin protein was increase after FKBP14-siRNA transfection in ovarian cancer cells.Conclusions:1. FKBP14 could significantly promote the proliferation, migration and invasion, inhibit the apoptosis of ovarian cancer cell line, suggesting that FKBP14 may be an oncogene during the development of ovarian cancer. FKBP14 has considerable potential as a therapeutic target for ovarian cancer treatment.2. FKBP14 shRNA inhibited ovarian cell proliferation via inducing G0/G1 cell-cycle arrest and cell apoptosis.FKBP14 exerted inhibitory effects on cell apoptosis via regulating the ratio of Bax/Bcl-2.3. FKBP14 shRNA could reduce the migration/invasion ability via regulating epithelial mesenchymal transition (EMT) and extracellular matrix (ECM).