Font Size: a A A

Molecular Epidemiological And Etiological Investigation Of Porcine Epidemic Diarrhea Virus In South China

Posted on:2015-10-24Degree:DoctorType:Dissertation
Country:ChinaCandidate:R Q SunFull Text:PDF
GTID:1223330467456579Subject:Prevention of Veterinary Medicine
Abstract/Summary:
Many piglets have turn into porcine diarrhea in a number of provinces in China since thelate2010. This results in the death of millions of piglets and a huge economical loss in pigindustry. To better understand the major pathogen, molecular biological characters ofpathogen, and route of transmission and pathogenicity, the following work have beenperformed in this study.1. Molecular epidemical survey on PEDV from2010to2014Sixty stool samples were collected from6pig farms in different districts of GuangdongProvince. Then we used PT-PCR to detect three main types of virus causing porcine diarrhea.These viruses include Porcine Rotavirus (PRoV), Transmissible gastroenteritis virus (TGEV)and Porcine Epidemic Diarrhea Virus (PEDV). The results showed that the detection rates ofthree types of virus were PEDV100%, TGEV16.7%and PRoV33.3%, respectively. Inaddition, the virus infection rates in60stool samples were PEDV85%, TGEV3%, and PRoV3%, respectively. The combination infection rates of two kinds of virus were1.5%(PEDVmixed with TGEV),3%(PEDV mixed with PRoV), and0(TGEV mixed with PRoV),respectively. There was no combined infection of three types of viruses. The above resultssuggest that the main pathogen in this porcine epidemic diarrhea was PEDV.We collected3101stool samples from pig farms distributed in Guangdong, Fujian,Hainan, Jiangsu, Henan, Shanxi, and some other provinces between2010and2014. RT-PCRwas used to detect PEDV. Meanwhile, the morbidity and mortality of piglets in40pig farmswith severe epidemic situation were collected. The outcome demonstrated that among3101stool samples from190pig farms, the positive rate of PEDV samples is64.9%(2012/3101),the positive rate of pig farms is93.1%(177/190), the average incidence among40pig farmsis62.7%, and the death rate is83.5%. The incidence of porcine diarrhea among piglets inGuangdong is61.2%and death rate of that is82.9%. The incidence of porcine diarrheaamong piglets among Fujian, Jiangsu and Hainan is65.2%and the relevant death rate is82.9%. In large-scale pig farms, the incidence of epidemical diarrhea among piglets is66.9%and the death rate is85.7%. In free-range pig farms, the incidence of diarrhea is49.3%and the death rate is74.2%. The above results show that PEDV is widespread and popular, andthere is no regional difference between piglets’ incidence and death rate of PED. And, themorbidity of piglets caused by PED were no obviously correlated to the size of pig farms.2. Isolated identification of epidemic strain PEDV and its pathogenicity on pigletsWe planted positive stool samples of PEDV collected from Zhanjiang in GuangdongProvince on cell Vero E6to cultivate and separate it after filtration, and then used PT-PCRand IFA (indirect immunofluorescence assay) to detect the PEDV. After that, virus wasseparated to detect its TCID50value. We used isolated virus to influence10three-days-agenegative CD (Colostrum Deprived) piglets to observe the appearance. When the piglets beginto have diarrhea, we take pathological anatomy on them and get histopathological observationon the gut-associated tissue, and a get gut tissue to take PEDV detection and separation at thesame time. The outcome shows that processed stool sample was planted on cell Vero E6andit was transmitted blindly to generation21to have CPE (cytopathic effects). The result ofRT-PCR shows PEDV positive and the detection of IFA shows obvious fluorescence. It isconfirmed that we separated a strain of PEDV, namely, CH/GDZJ/11. The TCID50value of itwas10-6.5/0.1ml.There was1piglet having diarrhea in10h after infection, and one of three infectedpiglets had vomit and diarrhea after2days. All the piglets had severe watery diarrhea,extreme depressed, dehydration and temperature rising. In the day5after infected, all thepiglets in infected group dead. However, there was no diarrhea and death in controlled group.After anatomy of piglets with diarrhea, there was much undigested clotted milk instomach, gastric mucosal hyperemia, thin and transparent intestinal canal, full gas, mostlydeciduous intestinal mucosa, and hemorrhagic intestinal tract. Observing gastrointestinaltissue biopsies of PEDV-infected piglets after24h, there was gastric mucosal epithelium,Glandular epithelium of intestinal metaplasia, serous layer vascular and lymphatic tube cavityexpansion, duodenal intestine pile serious atrophy, fossae, mucosal epithelium mucosa layerserious fall off, lost in structure, lamina propria intestinal epithelial degeneration necrosis,submucosa to expand blood vessels and lymphatic vessel lumen. These results showed thatseparated strain of PEDV, namely, CH/GDZJ/11, had severe pathogenicity and will pose harmto digestive tract of piglets.3. Molecular biology characteristic analyses on epidemic strain of PEDV including S, M,ORF3between2010and2014PEDV S1, S2, M and ORF3genes were amplified by RT-PCR in69fecal samplescollected during2010to2014. These nucleotide and amino acid sequences were analysis bybiological information to reveal the identity, point mutation and genetic characteristics. List results of PEDV S1, S2, M and ORF3as follows:The segment of PEDV S1from epidemic strain was consist of1596nucleotide, whichwas coded592amino acid. The similarity of S1segment between pandemic strain of PEDVand reference strains in nucleotide and amino acid sequences were90.4%~99.9%and85.5%~99.0%respectively, while the similarity of pandemic strains were96.7%~100%and93.8%~99.8%, respectively in each other. Compared to CV777, the common abrupt changepoints of gene S1in pandemic strain in nucleotide and amino acid levels were107bit and51bit. In addition, on163~178and421~423bit of nucleotide, we planted2segments and6bases were missing on481~486bit. CV777S1protein contains9glycosylation sites,epidemic strains contain8, and S1segments had no transmembrane structure while there wassignal peptide on1~20bits. Compared to CV777, hydrophobicity of pandemic strain S1protein was changed on its45~50bit,95~100bit and125~130bit of amino acid sequences.The similarity of S2segment between Pandemic strain of PEDV and the reference strain onnucleotide and amino acid were93.9%~99.8%and89.5%~100%respectively, while thesimilarity in pandemic strains were96.7%~100%and94.6%~99.5%respectively. Likewise,the common abrupt change points of gene S2in pandemic strain in nucleotide and amino acidlevels were20bit and13bit, and there is no insertion or deletion of amino acid residues.Transmembrane structures of CV777S2section were in418~440aa, but transmembranestructures of other reference strain and pandemic strain were in417~439aa. However, therewas no transmembrane structure among pandemic strains including CH/FJZZLWM/13,CH/GDMMHZ/13, CH/FJZZLWM/13, CH/GDMMSD/13, CH/GDJMHS/13in thisexperiment.The M gene from epidemic strain was consist of678nucleotide, which was coded226amino acid. The similarity between pandemic strains and reference strains in gene nucleotideof PEDV ORF3and amino acid were96.5%–100%and97.3%~100%; respectively, whilethe similarity in pandemic strains were97.4%–100%and94.1%–100%, respectively.These nt and aa sequences contained a few of point mutation, but without inserion or deletion.M protein contains1-2glycosylation sites. M protein contains3transmembrane structures,located in20-38,43-65and75-97. Compared to CV777, M protein has changes ofhydrophobicity located in10-20aa sequences.The ORF3gene from epidemic strain was consist of672nucleotide, which was coded224amino acid. The similarity between pandemic strains and reference strains in genenucleotide of PEDV ORF3and amino acid were95.6%~100%and92.4%~100%respectively,while the similarity in pandemic strains were98.8%~100%and95.5%~100%, respectively.Pandemic strain ORF3nucleotide sequence inserts a base (TGCCCGCTGCTGTATTATTGCGGCGCGTTTCTGGATGCGACCATT) in247~291bit,and inserts an amino acid sequence (YCPLLYYCGAFLDATII) in82~98bit. ORF3proteincontains two glycosylation sites, which are22NLSL and43NVTG respectively. ORF3protein contains2transmembrane structures, located in41-63and63-98. Compared toCV777, ORF3protein has3changes of hydrophobicity. According to the gene sequences ofamino acids of PEDV S1, S2, M and ORF3, all strains could be divided into two groups, andrelationship between pandemic strain and American strain and Thailand strain is close.However, the relationship between CV777, Chinju99and Brl/87and China’s previous strains(CH/S and LZC) was far. The above results shows that there is a wide range of mutation incurrent epidemic strain S gene nucleotide and amino acid sequence, and the hydrophobic andglycosylation of them also have changed, which may explain the current TGEV-PEDV(CV777) duplex inactivated vaccine in clinic cannot effectively protect the pig against PEDVinfection. According to the gene characteristics of ORF3, virulent strains prompt the currentepidemic strains.4. Transmission route of PEDVThere are three pig farms (A, B and C) that have recurrent PED epidemic situation andthus were selected as study objects. We collect21pig sperm samples,51air samples and72pig milk samples from3pig farms, and then RT-PCR and real-time RT-PCR were used todetect PEDV and its volume. In the meantime, stool of recovered piglets in pig farm B wascollected and then RT-PCR was used to detect the PEDV in samples. The method in thecollection was10pieces a week and the collection lasts8weeks. The outcome shows that allthe stool samples were positive in PEDV14days after the recovery of piglets, and their viralcontent can reach up to106.58copies/ml. A half of the stool samples were detected PEDV49days after recovery and the viral content decrease (101.69~103.27copies/ml). Only30percentof piglets were detected PEDV56days after recovery of piglets and the least viral content is101.45copies/ml. Therefore, these results indicate that after recovery the piglets still expelvirus and the isolation time should be more than56days.We detected all the samples from piglets and found that sperm of male piglets hadpositive PEDV, in which the rate was16/21. The viral content was between101.46copies/mland103.65copies/ml. The detection rates of PEDV in air were0%,12.2%and6.7%,respectively in pig farms A, B and C. The milk samples of expectant and lactating sows weredetected PEDV. Besides the accepted faecal-oral route, the transmission route of PEDV mayinclude sow-milk-piglet and boar-sperm-sow which influence piglets and cause the epidemicof PED. In addition, aerosol is a potential route that accelerates the epidemic of PED.In conclusion, the primary reason that led to widespread piglets’ diarrhea is attributed to PEDV. From the pathogenicity of separated strain CH/GDZJ/11, we can find that currentepidemic strain PEDV is virulent strain. The epidemics of this virus have no regionalselection. Gene S in PEDV epidemic strain has been mutational and it finally causes thechanges of antigenic protein, which maybe one of the reasons why inactivated vaccinesCV777fail. In addition, besides the faecal-oral route, two other routes includingsow-milk-piglet and boar-sperm-sow can cause the continued infection of PEDV andrepeating outbreaks of PED. Meanwhile, aerosol is a potential route that accelerates theepidemic of PED. After the recovery of infected piglets, it still can expel virus, implying thatthe recovered piglets can still expel virus and the period of separation should be more than56days.
Keywords/Search Tags:Porcine epidemics diarrhea, Porcine epidemics diarrhea virus, Molecularepidemiology, Molecular biological characteristics, Pathogenicity, Transmission route
Related items