Regulation Of MDSCs Differentiation In Cell Implantation Treatment Of Stress Urinary Incontinence

Intrinsic sphincter deficiency(ISD) which is characterized by malfunction of the urethral closure is an important cause of stress urinary incontinence(SUI), especially in old women. There are still no long-term effective treatment for SUI due to ISD. Since patients with ISD have myogenic-dominant damages with urethral sphincter, stem cell transplantation may be a better way for repairing muscle injury so as to correct the defects in structure and function of sphincter urethral muscle thoroughly.Muscle derived-stem cell(MDSCs),a highly undifferentiated multipotential cell,is characterized by rapid proliferation, slow fusing and multipotential differentiation. Its survival rate is significantly higher than that of satellite cells after transplantation. So it may be an ideal cell used for therapy of SUI with better alloimmunity regulation ability. Previous study showed that MDSCs injected into bladder smooth muscle layer and urethra survived and formed myofibrils, but Kwon compared MDSCs and fibroblasts in regard to their potential for restoration of urethral function following injection. The result revealed that no significant difference between MDSCs and fibroblasts or a combination of both, when the cell dosage was equal across the groups. The question whether the treatment effect of the MDSCs is hindered by the transdifferentiation of fibroblast is unknown.The muscle recovery involves the competition between fibrosis and regeneration, therefore earlier stage recovery of traumatic muscles should be emphasized since more longer fibrosis would lead to less recovery possibility. under normal condition ,that source for the muscular recovery is derived from myogenic precursor cells and activated early in the healing process either by fusing with the local myofibers or by generating new myofibers. but the functional recovery of the muscle often is hindered by the transdifferentiation of fibroblast Several studies have shown that myogenesis is also regulated by a number of growth factors, including fibroblast growth factor, insulin-like growth factor and transforming growth factor-b (TGF-b) TGF-βplays a key role in tissue repair and fibrosis, partly due to its capacity to induce myofibroblast differentiation. Smad3 is central in transducing TGF-b signaling during myogenesis.Smad3 mediates TGF-βsignaling related lung fibrosis and bronchial smooth muscle fibrosis.An in vivo study shows that loss of Smad3 greatly attenuated morphologic evidence of fibrosis in bleomycin-treated mice, thus implicating Smad3 in the pathogenesis of fibrosis. However, the Smad pathway and its possible role in mediating TGF-β1 induced MDSCs fibroblast differentiation have not been determined.In this study we characterized the muscle-derived stem cells (MDSCs) isolated from rat gastrocnemius muscle, and examined whether blocking TGF-β1/Smad3 signaling pathway would inhibition the fibroblast differentiation effect of MDSCs in SUI rat.MethodsThe study was carried out from September 2006 to march 2009 at the department of Obstetrics and Gynecology, First Affiliated Hospital, Third Military Medical University. The experimental protocol was approved by Ethical committee for animal studies of the Third Military Medical University.1 Materials1.1 Experimental AnimalsThe experiments were performed on female Sprague-Dawley rats(3-4 weeks old) purchased from Experimental Animal Center, Research Institute of Third Military Medical University.1.2 Isolation, culture and purification of MDSCsThe hind limbs (gastrocnemius muscles) were removed from 3⁶ week-old S-D rats.Skin and bone were removed. The muscle mass was minced and chopped with razor blades, and the cells were dissociated using two enzymes (collagenase XI and dispase) for 1 h at 37℃.The muscle cell extract was preplated on culture flasks as described by Qu. The phenotypic characteristics of pp6 cells were detected by immunostaining for Sca-1, CD34 and desmin.1.3 Immunocytochemical staining for muscle-derived stem cells Cells were plated in a 6-well culture dish and fixed with cold methanol (-20℃) for 1 min. After rinsed with PBS, cells were blocked with 5% horse serum at room temperature for 30 min. The primary antibodies Desmin(1:200; Sigma), goat Sca-1(1:200 R&D),Vimentin(1:200 Sigmia))were applied overnight at room temperature. The immunofluorescence labeled second antibody(FITC-conjugated secondary antibodies or TRITC-conjugated secondary antibodies) were applied for 60 minutes at 37℃.Fluorescein isothiocyanate(FITC)-conjugated anti-CD34 antibodies was used to stain MDSCs. Nuclei were stained with DAPI(Beyotime). The cells were then rinsed with PBS and visualized by fluoroscopy.1.4 Generation of lentiviral vector for silencing of rat Smad3 expressionFrom the Smad3 cDNA coding sequence: four pairs of cDNA oligonucleotides targeting Rat Smad3 mRNA at different locations were choosen (Table 1).These primers were annealed and inserted into pGCSIL-GFP (Genechem,Inc., Shanghai, China). Different siRNAs were screened by cotransfection with a rat Smad3 cDNA plasmid into 293T cells with Lipofectamine 2000 (Invitrogen Corporation, Carlsbad,CA, USA). To examine the efficiency of these targets in silencing Smad3 expression, Smad3 protein levels were measured using western blottingThe optimal sequence of siRNA against rat Smad3 was then cloned into the plasmid pGCL–GFP, which encodes an HIV-derived lentiviral vector containing a multiple cloning site for insertion of shRNA constructs to be driven by an upstream U6 promoter and a downstream cytomegalovirus promoter–GFP fluorescent protein cassette flanked by loxP sites. Lentivirus preparations were produced by the Shanghai GeneChem, Co. Ltd, China. The resulting lentiviral vector containing rat Smad3 shRNA was named GC-shSmad3, and its sequence was confirmed by PCR and sequencing analysis. MDSCs were infected with GC-shSmad3 by addition of lentivirus into the cell culture at an MOI of approximately 100. After 5 days of infection, MDSCs were serum starved for 24 h and then treated. 1.5 RNA isolation and qRT-PCRTotal RNA from MDSCs was extracted using Trizol reagent, and first-strand cDNA was generated using the ImProm-II? Reverse Transcription System (Promega). qRT-PCR was performed using the primers of Smad3 (5'-ACACAATAACTTGGACCTACAG-3'; 5'- GTGAAGCGTGGAATGTCTC-3). Vimentin(5'-TCCCTGAACCTGAGAGAAAC-3'; 5'- ATCGTGGTGCTG- AGAAGTC-3) Desmin(5'- CCTACACCTGCGAGATTGATG -3'; 5'- GCGATGTTGTCCTGATAGCC -3) Amplifications were performed in 45 cycles using an opticon continuous fluorescence detection system (MJ Research) with SYBR green fluorescence. Each cycle consisted of 5 s at 95℃, 30 s at 60℃. All samples were quantified using the comparative CT method for relative quantification of gene expression, normalized to GAPDH1.6 Western blottingTwo hundred thousand MDSCs or MDSCs infected with GC-shSmad3 were seeded into 25-cm2 flasks in Dulbecco's modified Eagle's medium containing 10 ng/ml of TGF-₁ for 0,3,6,12,and 24 h. then the cells were lysed in buffer and the Iysates were separated by 10% SDS–PAGE. The proteins were transferred onto a nitrocellulose membrane (Bio-Rad). After incubation with mouse monoclonal anti-Vimentin (1:1 000 dilution; sigma), mouse monoclonal anti-Desmin (1:1 000 dilution; sigma)or Rabbit anti-smad3(1:200 dilution; Cellsignaling).The blot was washed with PBS and incubated with goat anti-mouse IgG conjugated with horseradish peroxidase (HRP; Zhongshan Biotech, China). Immunoreactive complexes were visualized by ECL and exposed to X-ray film. The density of Vimentin and Desmin protein bands was assayed by gel documentation system and QUANTITY ONE software. 1.7 Establishing rat model of SUIThe rats were given pentobarbital sodium anesthesia, surgery was performed through a dorsal incision in the skin and an incision in the muscle over the ischiorectal fossa. The pudendal nerve were exposed on each side and a 2 cm segment was removed just distal to the origin of the pudendal nerve from the sciatic nerve.1.8 MDSCs Injectionfemale SD rats (250?300 g) were divided into 4 groups:Control (CON),denervated (SUI), denervated + MDSCs infected with a negative control lentiviral vector(MOCK),and denervated+ MDSCs infected with GC-shSmad3 (KD), The rats were given pentobarbital sodium anesthesia, a low midline incision was made to expose the bladder and urethra 50ul of cells suspension was injected with a microinjector, about 1×106 MSDCs per rat.1.9 Urodynamic Test2 weeks and 4 weeks after injection, urodynamic tests were performed.5 rats were taken from each group The rats were mounted on a table and placed in the dorsal position. A transvesical epidural catheter was inserted into the dome of the bladder, the other end of epidural catheter was connected with urodynamic detection and microinfusion pump through a three-way stopcock. Bladder emptied and saline solution was injected into bladder with the speed of 0.3ml/min.The pressure at the first drop leaked out from the urethral orifice was taken as leak point pressure(LPP).1.10 Statistical analysisValues are shown as means±SD. One-way ANOVA was used to compare the means from two or more experimental groups, followed by t-tests. Statistical differences between groups were considered to be significant at p < 0.05.2 Results2.1 Isolation and identification of MDSCs We isolated MDSCs from rat gastrocnemius muscles. The results show that immunofluorescence stains in muscle-derived cells are Desmin(+),CD34(+),Sca-1(+),CD45(-). They were therefore muscle-derived stem cells and were used for further experiments.2.2 Suppress rat Smad3 expression by GC-shSmad3Four shRNA-expressing plasmids were constructed using the pGCSIL-GFP vector to target Rat Smad3. One negative control shRNA containing a scrambled sequence with the same nucleotide composition was also constructed. The efficacy of these plasmids was examined by western blotting.ShRNA plasmids showed variable efficacy, the most effective shRNA is shRNA1. The optimal sequence of siRNA against rat Smad3 (5'-GGATGAAGTGTGTGTAA AT-3') was then cloned into the plasmid pGCL–GFP. MDSCs were infected with GC-shSmad3.The transfection efficiency was more than 80% showed by fluorescent microscopy analysis in MDSCs. The expression of Smad3 were monitored by quantitative realtime RT-PCR (qRT-PCR) and western blotting after the MDSCs cultured with TGF-β1 (10 ng/ml ) for 24 hours. With the most effective shRNA,shRNA1, The effective silencing of endogenous rat Smad3 by GC-shSmad3 was confirmed by western blot analysis, The Smad3 silencing rate was 80% confirmed by qRT-PCR2.3 TGF-β1/Smad3 signaling in the fibroblast differentiation of muscle-derived stem cellWe have tested whether the stimulation of MDSCs cells with TGF-β1 will induce the expression of fibroblastic markers vimentin and whether blocking the TGF-β1/Smad3 signaling by vector-mediated Smad3 shRNA will suppress the fibroblast differentiation of muscle-derived stem cell. We also observed the changes of muscle-specific marker Desmin in these process. The result confirm that the expression of vimentin in the MDSCs can be induced by TGF-β1 stimulation in a time-dependent manner, but the expression of desmin were suppressed by TGF-β1.Inhibition of Smad3 with vector-mediated Smad3 shRNA significantly suppressed TGF-β1-induced effect of fibroblast differentiation.2.4 Urodynamic Test after cell transplantationUrinary dynamics detection for SUI models showed that LPP increased significantly. The phenomenon of SUI become weaken or disappear after injection. LPP in the MDSCs groups were significantly lower at 4 week than at 2 weeks. There were no such differences between 2 and 4 weeks in the CON and KD groups. LPP in the KD group were significantly higher than MOCK group at 4 week3 DiscussionTaken together, We have isolated and purified MDSCs by the preplate technique. We Construct GC-shSmad3 lentiviral vector for silencing of rat Smad3 expression. The increased expressions of Vimentin and down-regulated of Desmin were found in MDSCs after culture with TGF-β1 in vitro, but TGF-β1 was unable to induce fibroblast differentiation of MDSCs in Smad3-deficient MDSCs, which exhibited accelerated myogenesis. In vivo testing showed that GC-shSmad3 lentivirus infection improved the MDSCs-mediated repair of urethral muscle, compared with MDSCs alone. Thus, we have shown GC-shSmad3 shRNA Inhibit the fibroblast differentiation of muscle-derived stem cell induced by TGF-β1 in vitro and improved the persistence of urethral muscle repair by preventing of muscle fibrosis in SUI model rat in vivo.Myoblasts is a promising source for cell transplantation because they can easily be harvested from skeletal muscle and expanded in culture. Previous study has demonstrated a population of skeletal muscle-derived stem cells (MDSCs), characterized utilizing a variety of stem cell markers (e.g., Sca-1, CD-34, Bcl2) .These cells readily undergo differentiation into myotubes, which foster long-term persistence of the grafts formed within injected skeletal. It have been shown to be able of circumventing the limitations of myoblasts and could prove to be a superior alternative to myoblasts for the regeneration and repair of skeletal, cardiac and smooth muscles. But Several methods have been used to isolate and purify skeletal muscle-derived stem cell populations. The most popular method is established by Qu, They used three step enzyme(collagenase XI ,dispase and trypsin) digestion and the preplate technique to enrich the desired cells This method was obviously too tedious and uncertain for routine use. We explore a better way of isolating and purifying skeletal muscle stem cells by two enzyme(collagenase XI and dipase) digestion and the preplate technique and identified the MDSCs with immunocytochemistry. We have demonstrated two enzyme digestion is a better cell isolation protocol which can ease the procedure, decrease cell injury and improve cell quantity and quality.The vectors have a high efficiency in gene delivery and can integrate genes into dividing stem cells,so we chose lentiviral vectors for gene transduction. Other virus vectors, such as adenovirus vectors, do not integrate into cells and thus the therapeutic transgene will be diluted over time. This may limit the use of adenoviral vectors for long-term expression of a potentially therapeutic gene. Our results show that high gene transduction efficiency (>80%) was achieved at day 5 after exposure to lentiviral vectors, suggesting gene integration.TGF-β1 has been considered a key factor in the development of fibrosis in various tissue。It has been suggested that TGF-β1 is capable of inducing the expression of myofibroblastic markers in MC13 cells,This phenomenon is also demonstrated in our experiment, In addition, we have further observed the expression of Desmin was dramatically reduced upon TGF-β1.These data suggest that TGF-β1 is probably involved in the differentiation of MDSCs toward fibroblast, which is accompany with inhibition of myogenesis.Smad3 is central in transducing TGF-β1 signaling during fibrosis and myogenesis. Therefore, we hypothesized that fibroblast transdifferentiation of MDSCs by TGF-β1 is also mediated by Smad3. We compared expression of Vimentin and Desmin in MDSCs infected with GC-shSmad3 lentivirus vector and MDSCs infected with a negative control lentiviral vector. The results have demonstrated that GC-shSmad3 lentivirus vector can attenuate the fibrosis reaction and this was concomitant with increased expression of differentiation-specific myogenic genes such as Desmin. The persistence of urethral muscle repair by preventing of muscle fibrosis was also observed by transplantation of MDSCs infected with GC-shSmad3 lentivirus vector to SUI model rat.Although we cannot exclude the participation of other growth factors in the fibroblast transdifferentation of MDSCs, it seems possible based on these results that TGF-β1, the key factor involved in the fibrosis of various tissues, also plays a role in the differentation of fibroblast formation of MDSCs, which likely also contributes to the development of fibrosis. Furthermore, inhibition of Smad3 expression is capable of suppressing fibroblast differentiation of muscle-derived stem cell and improved the persistence of urethral muscle repair by preventing of muscle fibrosis in SUI model rat in vivo. It may provide a novel strategy for the treatment of SUI ,which may improve the effect of MDSCs treatment for female SUI patients.