The Relationship Between Tspan-5 And Metastasis Of Colorectal Carcinoma

Colorectal carcinoma.(CRC) is a kind of maliganat tumor which has high attack rate and death rate.Although maliganat tumor has many biological characters, including metastasis,independence,and dedifferentiation and so on,but the most important one is metastasis.CRC's high death rate is mainly concerned with metastasis.Important as it is,research about the mechanism of CRC metastasis is remained backward in contrast with other research field of CRC.Because mechanism regards CRC metastasis is very complicated.Rcently,with the rapid development of molecular biology,focus of carcinomor metastasis research graduly switch from cytoplast to cytomembrane,to investigate the influence of membrane receptor's denomination and mode of action to metastasis.Tetraspanins(also referred to as tetraspans or TM4SF proteins) are a family of widely expressed four-transmembrane-domain proteins.Tetraspanins are postulated to have a topology in which there are two extracellular loops(a small loop between the first and second transmembrane(TM) domains,and a large loop between the third and forth TM domains),an interconnecting intracellular loop(between the second and third TM domains),and cytoplasmic N- and C-termini.Although the external location of the extracellular loops has been confirmed experimentally,the cytoplasmic location of the four consecutive hydrophilic residues of the interconnecting loop remains a point of speculation.More and more study certificated that TM4SF proteins play an important role in migration of malignant tumor.TSPAN-5,which is a member of the tetraspanin superfamily,is prominent expression in the brain.More detailed studies show that mouse TSPAN-5,is highly expressed in cortical structures including the hippocampus,and in other brain regions. TSPAN-5 is important to the maintenance of brain activity.TSPAN-5 contains a putative PKC phosphorylation signal at the intracellular amino terminus,suggesting a role in intracellular signalling.In contrast with other members of TM4SF,CD9 for example,stuys about the relationship between TSPAN-5 and tumor are very few,let alone the relationship between TSPAN-5 and colon cancer.The present study manages to screen the differential expression genes among three cell lines which own different metatasis potency via cDNA microarray,and then select genes that may play a role in the metastis of carcinoma for further investigate. We aim no only to investigate the molecular mechanism of tumor metastasis,but also to search new effective target for predict malignancy and gene therapy.Testing difference of metastasis ability of three CRC cell linesIn vitro,adhesive and motility experiment were used to assay metastasis ability of LST-R1,SW480 and Lovo cell lines.As to adhesive experiment,collageonâ…£was used as adhesive mediator.CRC cell lines(1×10⁸/L) were incubated with collageonâ…£in the condition of 37℃,50mL/L CO₂ for 1 hour.As to mobility experiment,the mobility of CRC tumor cells was assayed in a transwell cell culture chamber.CRC cell lines(1×10⁸/L) were incubated in up chamber while NIH3T3 culture supernatant in down chamber in the condition of 37℃,50mL/L CO₂ for 6 hour.The result showed that there were difference of adhesion and mobility ability among LST-R1,SW480 and Lovo.Lovo had the strongest ability of adhesion and mobility,indicated that Lovo had the strongest ability of metastasis. cDNA microarrayThe criterion(mean signal value of a pair of sample＞2,or one＜2,but the other＞10;coefficient of variance＜0.33;difference of signal value more than 2 times) was used as to judge the differential expression of genes.Among up regulated genes, Dynamin2,ARF-1 and CAPZA-2 can affect metastasis.Among down regulated genes, TSPAN-5 may affect metastasis.The expression of TSPAN-5 in CRC carcinoma was first reporten by our research,so we selected TSPAN-5 for further research.Validation of cDNA microarray's resultSemi-quantitive RT-PCR was used to validate TSPAN-5 expression level in Mrna expression level.Immunohistochemistry,Western-Blot and flow cytometry were used to validate TSPAN-5 expression level in protein expression level.The results coincidence with cDNA microarray' result.Positioning study of TSPAN-5 in intestine tissueTspan-5 expression increase with colon cancer progression:in normal colon mucosa, Tspan-5 was either absent or barely detectable.Tspan-5 expression was nearly negative in benign polyp but began to increase in adenomas with atypical hyperplasia. An even stronger expression of Tspan-5 was found in primary colorectal carcinoma and the strongest in metastases cancer.In colon cancer on different Dukes' stage, Tspan-5 expression in colon cancer on Dukes' A was lower than that in colon cancer on Dukes' stage B,C and D.The 3-years survival rate of patients which have higher Tspan-5 expression level was lower than that of patients which have lower Tspan-5 expression level.Establishing of stably expressed Tspan-5-GFP fusion protein LST-R1 cell lineTspan-5/pEGFP-C₁ recombinant plasmid was successfully established by molecular cloning technique.LST-R1 cell line was transfected Tspan-5/pEGFP-C₁ recombinant plasmid and pEGFP-C₁ plasmid by Lipofectamine 2000^TM.After 3 weeks screening by G418(1000μg/mL),the transected cell could stably exist in G418(1000μg/mL) culture condition.LCSM shows that Tspan-5-EGFP fusion protein located on cellular membrane,while GFP protein located in cytoplasm.Western blot detection by anti-Tspan-5 primary antibody showed Tspan-5-GFP was expressed in stable clones.Tspan-5 RNA interferenceRNA interference(RNAi) technique was used to down regulate LoVo's Tspan-5 expression level.Sequences of Tspan-5-silencing shRNAs were designed,synthesized,and cloned into pGPU6/GFP/Neo plasmid(using the BbsI and BamHI restriction sites).The targeted sequence that we found effectively mediated the silencing of the expression of Tspan-5 is as follows(only sense sequences are shown)CACCGCTGATGATTGGAACCTAATTCAAGAGA TTAGGTTCCAATC ATCAGCTTTTTTG(Tspan-5/453).The irrelevant sequences that we used as control are as follows:5'-CACCGTTCTCCGAACGTGTCACGTCAAGAGATTACGTGA CACGTTCGGAGAATTTTTTG-3'(Tspan5/N).Lipofectamine 2000^TM was used to transfect recombinants into LoVo cells.Stable transfectants were selected in RPMI 1640 containing G418 at 1000μg/ml.Western-Blot was performed to test the effect of RNAi in stable transfected LoVo cells..Testing difference of metastasis ability after alter Tspan-5 expression levelIn vitro,adhesion,motility,invasion experiment were used to assay cell metastasis ability after alter Tspan-5 protein expression level.The result showed that colon cancer cells' adhesion,migration and invasion ability were enhanced after up regulated Tspan-5's expression level,and were inhibited after down regulated TSPAN-5's expression level.The interaction between Tspan-5 and integrinβ1Endogenous integrinβ1 can be co-immunoprecipited by anti-Tspan-5 antibody from various human colorectal cancer cell lines,Immunofluorescence staining shows that endogenous integrinβ1(green) was colocalized with Tspan-5(red) at focal adhesions in spreading LoVo cells and SW620 cells. Down-regulation of Tspan-5 expression level can significantly inhibit LoVo cell metastasis in vivoNude mouse liver metastases were analyzed 3 weeks after spleen injection of LoVo cells.The result shows that down-regulation of Tspan-5 expression level can significantly inhibit LoVo cell liver metastasis in nude mouse.From the results above,we may draw conclusions as following:1.LST-R1,SW480 and Lovo cell lines have different metastasis potency.2.LST-R1,SW480 and Love cell lines can express Tspan-5,and the one that has higher metastasis potency has higher Tspan-5 expression level..3.Colon membrane mucosa cell can express Tspan-5,and in contrast with normal colon membrane mucosa cell,tumor cells owned higher expression level than normal membrane mucosa cell.Tspan-5 expression has positive relation with colon cancer progression.4.Colon cancer cells' adhesion ability was enhanced after up regulated Tspan-5's expression level,vice versa.5.Alteration of TSPAN-5 protein expression level can significantly effect colon cell lines' migration and invasion ability.Up-regulation of Tspan-5 expression level could enhance CRC cell migration and invasion ability,and vice versa.6.Tspan-5 can interact with integrinβ1.7.Down-regulation of Tspan-5 expression level can significantly inhibit LoVo cell metastasis in vivo...