Font Size: a A A

Molecular Genetics Of Limb Malformations: Mutation Identification In HOXD13, TNNI2 And TPM2

Posted on:2007-08-18Degree:DoctorType:Dissertation
Country:ChinaCandidate:X L ZhaoFull Text:PDF
GTID:1114360218456102Subject:Genetics
Abstract/Summary:
Congenital limb malformation (LM) is one of the most common birth defects with anincidence ranging from 1/500 to 1/1000 live births in general population. The etiology canbe subdivided into two general categories, environmental and genetic. The environmentalfactors include viral infection, ionizing radiation, chemical teratogen, poor uterineenvironment and maternal metabolic diseases. A well known tragic example of LMresulted from an enviommental factor is the thalidomide- associated phocomelia. Thegenetic factors refer to gene mutations and chromosomal aberrations. They can cause LMswith variable expressivity and genetic heterogeneity. These LMs may present as an isolatedtrait or as part of a genetic syndrome. Many gene mutations and chromosomal aberrationsmay lead to abnormal morphogenesis thereby causing various developmental defects.Syndactyly (SD), brachydactyly (BD) and ectrodactyly result from incompletemorphogenesis while polydactyly represent a consequence in formation of accessary tissue.Some LMs, such as distal arthrogryposis (DA), may be decondary to joint, muscle andneurologic functional defects often seen in many genetic disorders. In the present study,five Chinese families with different LMs were clinically analyzed, and genetic mapping,mutation identification and preliminary functional characterization were undertaken.I. HOXD13 Mutations in Different SDs and BDsSD refers to fusion of soft tissues of fingers and/or toes with or without fusion, whileBD is characterized by the shortening of the fingers and/or toes due to hypoplasia oraplasia of phalanges and/or metacarpals/metatarsals. Both SD and BD can occur as anisolated trait or as part of syndromes. On an anatomic and genetic basis, nonsyndromicSDs have been classified into five types (typesⅠtoⅤ), whereas nonsyndromic BDs havebeen classified into five types (BDA to BDE) including six BDA subtypes and three BDEsubtypes. The disease-causing genes for SD typesⅡandⅢhave been identified to be HOXD13 and GJA1, respectively. Mutations in IHH, BMPRIB, ROR2 and GDF5 cancause BDA1, BDA2, BDB and BDC, respectively. A recent study showed that a missensemutation in GDF5 was also associated with BDA2. Human HOXD13 gene has two codingexons with the imperfect GCN (N=A or C or G or T) triplet repeats-containing exon 1encoding the N-terminal 252 amino acids with a 15-residue polyalanine tract and thehomeobox region-containing exon 2, like all other HOX genes, encoding the C-terminal 83amino acids with a homeodomain (HD) of 60 amino acids. SD typeⅡ, also calledsynpolydactyly (SPD), is caused by polyalanine expansion (PAE) in HOXD13. However,missense mutations in the HD of HOXD13 lead to BDD and BDE. Therefore, differentmutations within a single HOXD13 gene underlie a wide spectrum of limb phenotypes. Wehave identified mutations of HOXD13 in three large Chinese families with different LMs.Family 1 had limb phenotypes in affected individuals closely resembling to SD typeⅤreported by Robinow and colleagues. Most of the affected individuals examined showedcomplete or incomplete fusion of metacarpals 4-5 which was the cardinal feature of SDtypeⅤ. None of the affected individuals had metatarsal fusion. Other hand deformitiesincluded ulnar deviation and shortening of distal phalanges of fingers 2 to 5, cutaneoussyndactyly between fingers 3-4 with or without bony syndactyly between fingers 4-5,shortening or clinodactyly of the 5th fingers, camptodactyly and absence of distalinterphalangeal creases. The most constant foot deformities were varus deviation of themetatarsals, valgus deviation of the toes, hyperplasia of the 1st ray, hypoplasia of the 2ndto 5th rays, and shortened and tucked 5th toes. Family 2 had limb features overlappingBDA4, BDD and BDE. Most of the affected individuals exhibited generalized shorteningof hands and feet. Absence of middle phalanges of toes 2 to 5 was a consistent finding inall affected individuals with radiographs. Shortening of middle phalanges of fingers 2 to 5were remarkable, with the 5th fingers severely deformed in all affected individuals and the2nd and 5th fingers the most frequent combination. Many shortened middle phalangesfused to the distal phalanges. Some affected individuals displayed short and broad distalphalanges of the thumbs, one or more shortened metacarpals and/or metatarsals, broad and short phalanges of halluces, and mild partial webbing between fingers 3-4 or toes 2-3.Family 3 had a typical SPD limb phenotype. Affected individuals showed bilateral orunilateral syndactyly between fingers 3-4 and toes 4-5, with a duplicated digit in thesyndactylous web.To map the disease locus in family 1, we first selected 6 highly polymorphicmacrosatellite markers within and flanking the HOXD13 gene for two-point linkageanalysis. LOD scores were calculated using the MLINK program of the LINKAGEpackage. A maximal LOD score of 4.90 was obtained for the marker D2S2314 atθ=0.00,showing definitive evidence of linkage. Haplotype analysis indicated no recombination at 5of the 6 genetic markers (D2S2981, HOXD13, D2S2314, D2S324 and D2S1391). Infamily 2, we have previously mapped the disease locus to the chromosomal region definedby 3 markers, D2S2981-HOXD13 and D2S2314. Therefore, we searched for pathogenicmutations of HOXD13 in the above-mentioned families. By direct sequencing of thePCR-amplified DNA fragments spanning exons 1 and 2 of the HOXD13 gene, weidentified in family 1 a missense mutation, c.950A>G, leading to substitution of the highlyconserved glutamine (Gln) by arginine (Arg) in HD (p.Gln317Arg) that was important forDNA-binding specificity and affinity. In family 2, we found a deletion of 21bp in theimperfect GCN triplet repeat sequence of exon 1, c.160180delGCGGCGGCTGCGGCGGCGGCG, resulting in a polyalanine contraction (PAC) of 7 residues (p.Ala54Ala60del). Infamily 3, we detected a duplication of 27bp,c.172198dupGCGGCGGCGGCGGCAGCGGCGGCTGCG(p.AIa58-AIa66dup), representing the most frequent PAE in HOXD13associated with SPD. By restriction analysis and/or polyacrylamide gel elctrophoresis,these mutations were confirmed to cosegregate with the LM phenotypes in affectedindividuals but not detected in all unaffected individuals of the families and not inunrelated control individuals. These data strongly suggested that c.950A>G (p.Gln317Arg)and c.160180delGCGGCGGCTGCGGCGGCGGCG (p.Ala54Ala60del) in HOXD13were novel pathogenic mutations. Additionally, we successfully performed prenataldiagnosis by haplotype analysis and direct mutation detection for one fetus in family 1 and two fetuses in family 3, respectively.To get more insight into the pathogenic mechanisms of the HOXD13 mutations, wecloned the wild-type HOXD13 and six mutants with different PAEs and PACs into thepEGFP C3 vector to drive expression of the fusion proteins tagged with GFP Transientexpression of these constructs in HeLa and COS-7 cells showed a nuclear localization ofwild-type HOXD13 and the PAC mutants, and cytoplasmic/nuclear localization of the PAEmutants, suggesting that the PAC and PAE mutations in HOXD13 might lead to BDs andSPD by different molecular mechanisms.In summary, we have identified HOXD13 as the gene responsible for SD typeⅤ,established the link between a PAC in HOXD13 and BD combined types A4, D and E, andfound the first PAE in HOXD13 in Chinese cases with SPD. Our results added two limbphenotypes to the phenotypic spectrum caused by HOXD13 mutations.Ⅱ. TNNI2 and TPM2 Mutations in DA type 2BDistal arthrogryposes (DAs) are the most common LMs secondary to the functionaldefects of joints and muscles. DAs occur in 1 in 3000 human live births. The characteristicprimary LMs in DAs include bilateral and symmetric clenched fist, overlapping fingers,camptodactyly, ulnar deviation of fingers, and positional foot deformities such as talipesequinovarus. Ten different forms of DAs have been recognized and classified. Theprototypic DA type 1 (DA1) has no additional abnormalities. Among the other nine formswith additional features, DA type 2A (DA2A) has facial phenotypes including a very smallorifice, H-shaped dimpling of the chin, prominent nasolabial folds, increased philtrumlength, small nose, blepharophimosis, deep-sunken eyes with hypertelorism. Severescoliosis may also be present in some cases. DA type 2B (DA2B) has features intermediatebetween DA1 and DA2A. Besides limb phenotypes, it may have facial features like atriangular face, downslanting palpebral fissures and small mouth. Point mutations in threegenes encoding contractile fast-twitch myofibers, TPM2 at chromosome 9p13 andTNNI2/TNNT3 at chromosome 11p15, were recently identified in DA1 and DA2B,respectively. We have recruited two Chinese families with DA2B and performed mutation analysisin TNNI2 and TPM2. In the seven-generation family 1, there were 32 affected individuals,most of them having clinical manifestations consistent with DA2B. However, intrafamilialvariation of phenotypic expression was remarkable. Three affected individuals hadscoliosis and two of them had bilateral hip dislocation. There were 3 affected individuals infamily 2. The proband had typical DA2B phenotypes while his two daughters displayedonly limb deformities. All 3 affected individuals showed short stature. Using the UCSCGenome Browser on Human 2004 May assembly, 4 perfect microsatellite repeat sequences(9p13AAC, 11p15CCT, 11p15GT and 20q13AC) close to the TPM2 gene, theTNNI2/TNNT3 gene and the TNNC2 gene, respectively, were selected as genetic markersfor two-point linkage analysis. In family 1, linkage analysis generated a positive LODscore of 3.61 atθ=0 with the marker 11p15CCT close to the TNNI2/TNNT3 genes. Bothof the two markers, 9p13AAC and 20q13AC, showed a LOD score of -∞atθ=0,excluding genetic linkage. In family 2, allele sharing was detected only at the marker9p11AAC close to the TPM2 gene and a positive LOD score of 0.91 was obtained. Theseresults suggested that mutations in families 1 and 2 might be in the TNNI2/TNNT3 andTPM2 genes, respectively. We first looked for mutation in the TNNI2 gene in family 1.Direct sequencing of the PCR-amplified genomic fragments containing all coding exonsrevealed a heterozygous small deletion in exon 8, c.523-525delAAG, in the proband. Thistriplet deletion resulted in the loss of codon 175, thereby causing deletion of lysine (Lys) atresidue 175 of troponinⅠ(p.Lys175del). BLAST search showed that the Lys at residue 175was highly conserved. Furthermore, this deletion was detected in all affected individualsbut not in unaffected family members and not in 50 unrelated normal controls. Similarly,we found a heterozygous missense mutation in the TPM2 gene, c.308A>G (p.Gln103Arg),in all affected individuals in family 2. Restriction analysis of PCR-amplified fragmentsspanning the mutation site indicated lacking of the mutation in 65 unrelated normalcontrols. This novel mutation would lead to change of the highly conserved Gln at residue103 ofβ-tropomyosin. Therefore, these two mutations should both be pathogenic. In summary, we have identified a novel small deletion of the TNNI2 gene and a novelmissense mutation of the TPM2 gene in two Chinese families with DA2B, respectively.Our work represents the first report on the link between TNNI2 and DA phenotype inChinese DA, and has showed that DA2B could be caused by a mutation in TPM2.
Keywords/Search Tags:syndactyly, brachydactyly, distal arthrogryposis, HOXD13, TNN12, TPM2
Related items