Cells can react to extracellular signals such as hormone and growth factors. These signals transduct into cells and then bring about biological effects. Cell signal transduction includes direct signal transduction( gap link between cells) and indirect singnal transduction(transmembane signal transduction). Intracellular signal transduction is fulfilled througu ras - MAPK and JAK - STAT pathways. The ras signal transduction pathway is as follows; growth factor receptor -GRB2 - SOS - ras - Raf - MAPKK - MAPK - transcription factors DNA synthesis. When ras gene mutates, not only its activity as a GTPase decreases,but it can resist the activation by GAP, and then the ras - GTP accumulates, resulting in proliferation state, and finally cancinoma is formed. MAPKs are very important signal transduction molecules that transduct signals from ras. MAPK is a kind of serine/threonine protein kinase, and its activation is through the phos-pholation by itself. MAPK is activatyed by MAPKK. The MAPKKK - MAPKK -MAPK signal transduction pathway can enlarge the signal from ras. MAPK has the great ability to catalyze other enzymes and is the intermediate of signal transduction in nucleus. The activated MAPK transduces the signal into cells, in which many transcription factors, such as jun, fos, myc, are activated through phospholation of there aminoacid residues and formation of dimers, such as jun - jun, jun -fos, which can increase the ability to combine DNA, and mediate and promote expression of genes mediating cell growth and differentiation. MAPK has many subtribes, and the first identified one was ERK(extracellular signal regulated kinases).In multicellular organisms, there are three mainly identified subtribes:ERK, JNK(c -jun NH2 -terminal kinases) and p38. ERK includes ERK1 and ERK2, and, JNK, JNK1,JNK2, and JNK3; p38, p38α, p38β, p38γ, and p38δ. ERK5 was found lately, and now ERK7,which may play a role in genome sequences, was found.Single transductors and activators of transcription ( STATs) , are a kind of DNA combined proteins, being made up of 750 -850 amino acids. Stat family in mammals includes STAT1 (α/β), STAT2, STAT3 ( α/β/γ ) , STAT4, STAT5 (a/b) ,STAT6. Cytokines activate Jauns kinase,which phosphorylate and activate STAT. When STAT was activated, it translocate into nucleus in the form of dimers. STAT combines specific DNA in promoter region in genes and takes effect. Other studies suggested that STAT was associated with tumors. In a lot of cancer tissues and tumor cell lines, activated STATs, especially STAT3, can be founded. The abnormally activated STAT3 can promote cell differentiation and increasement, and inhibite cell apoptosis, leading to tumor cell generation and development and chemotherapy resisting cell lines.MAPK - STAT interaction may exist in cells, and the mechanism is unclear. We explored whether ras modulate the expression of STAT3, and relation between ras - MAPK and JAK - STAT signal transduction pathways and their functions on generation and development of NSCLC, in order to find new tarket for diagnosis and treatment for non small cell lung cancer.Materials and Methods1. materials42 NSCLC patients for operation from 5 to 7, 2002 were selected, 31 of which were men and 11 were women. They aged from 34 to 75. 27 patients were squamous and 14, adenocarcinoma, 1, adenosqumaous cell carcinoma. 16 patients were in stage â… , 11, in stage â…¡ , and 15, in stage â…¢; 10 tumors were highly differentiated, 19, mediumly differentied, and 13, poorly differentiated. All patients didn' t have radiotherapy and chemotherapy before operation. Tumor tissues and normal tissues next to them were resected, which were put into liquid nitrogen, and then were put into refrigerator of -70℃.71 paraffin burieds slices of resected samples from 12,1997 to 12,1998 were selected. Of all the patients, 53 were male and 18 were female, aging from 33 -70. Tumor location was determined by CT. All the resected samples were pathologically detected to determine differentiation, histological type, and tumor staging. Of all 71 non small cell lung cancer, 47 were squmaous, 20, adenocarcinoma, 4, adenosqumaous. 19 were highly differentiated, 39, mediumly, 13, poorly. 48 were NO,23, N1 -2. All tumors were primary, without chemotherapy or radiotherapy. All patients were followed by 5 years.2. Methods2. 1 Western blot: normal and cancer tissues were cracked, and then RI-PA buffer was put into them, incubated in ice. Protein concentration was determined by Coomassie Brilliant Blue method. 50 ug protein samples were put into every lane for SDS - PAGE. Then transfer membrane. The first and second antibodies were put into them for hybridization. ECL reaction was conducted and the film was exposed in dark room. The relative quantity of each protein was determined by the ratio of β- actin by Bandleader software.2.2 RT-PCR:A little cancer and normal tissues were cut. Total RNA were distilled and PCR was conducted. The reversal transcription system was as follows: primers, 1μl 5 × buffer,0. 5μldNTP,0. 25μl RN ase inhibitor were put into 2ug total RNA. PCR system; 2μl 10 × buffer,0. 8μl primer 1,0. 8μl primer2 ,0.2μl TaqTM,16.2μl ddH2O were put into 5 μl RT product. The primers are as follows :p38(340bp): 5' GATGAAATGACAGGCTACG 3'5' CAAGCATCTTCTCCAGCA 3' STAT3 (368bp) : 5' GAGGCATTCGGAAAGTAT 3'5' TCACCCACATTCACTCA1T3' β -actin(540bp): 5' GTGGGCCGCTCTAGGCACCAA3'5' CTCTTTGATGTCACGCACGATTTC3'Thr product was for agar gel electrophoresis. The relative quantity of each mRNA was determined by the ratio of β - actin by Bandleader software.2.3 Immunofluorescence; frozen tissue slice was fixed in 4% formal -dehyde,then was put into Triton X -100. The first and second flurescence antibody were put into them consecutively. The slice was enveloped by glycerin and was observed using fluorescence microscope.2.4 immunohistochemistry:Samples were put into 3% H2O2, and antigens were repaired in microwave oven by 10 minutes in 95 -96℃. All samples were blocked in 10% goat serum for 30 minutes. First and secondary antibodies were put onto the slices consecutively, then SABC and DAB were put on them for color display. Standard: ( - )the ratio of positive cells <5% ; ( + )5% -20% ;( ++ ) >20%. ++ and up were considered as positive.Results1. Expression of ras, p38 and STAT3 different tissues;Of all the 42 patients,the relative quantity of ras, p38, and STAT3 was 0. 6012,0.6724,0.5119 in cancer tissues, and 0.6012,0.6724,0.5119 in normal tissues, respectively. The expression of them in cancer tissues was more than that in normal tissues( P <0.01)2. The expression of p38 and STAT3 in cancer tissues with different ras expression :1) In cancer tissues with high ras expression, the relative quantity of p38 and STAT3 is 0.7624 and 0.6262, higher than that in normal tissues.2) In cancer tissues with high ras expression, the relative quantity of p38 and STAT3 mRNA is 0.7624 å’Œ 0.6262, higher than that in normal tissues.3. Correlation of ras, p38, and STAT3:ras has a significant correlation with p38 and STAT3; the correlation coefficient is 0. 809 and 0. 842, respectively. p38 has a significant correlation with STAT3; the correlation coefficient is 0. 829. STAT3 is positively correlated with p38; the expression of STAT3 is increased with that of p38.4. Distributing differencre of p38 and STAT3 in lung cancer tissue and normal lung tissues.In cancer tissue, expression of p38 and STAT3 mainly located in nucleus...
|