Font Size: a A A

Studies On Cloning And Expression Of Human Laminin Alpha4 Chain LG4-5 Module

Posted on:2004-12-26Degree:DoctorType:Dissertation
Country:ChinaCandidate:J Q LianFull Text:PDF
GTID:1104360095462895Subject:Biochemistry and Molecular Biology
Abstract/Summary:
The laminins (LN) are a family of modular proteins that provide an integral part of the structural scaffolding of basement membranes in almost every animal tissue. In addition to interacting with cell surface receptors such as integrins and alpha-dystroglycan, they function as structural components and are essential for morphogenesis. By virtue of their receptor interactions, they initiate intracellular signaling events that regulate cellular organization and differentiation. These interactions of laminins are mediated by binding sites, often contributed by single domains, which may differ in various laminins. Laminin G domain-like (LG) modules of approximate 180-200 residues are found in a number of extracellular and receptor proteins and often present in tandem arrays. LG modules lie in C-termini of Laminin alpha chain and contain many sites, which are important for the interactions of laminins with their receptors and ligands. Studies on LG modules will help to investigate the functions of laminin in cell differentiation, growth and movement, and also in tumor metastasis and infiltration.Cloning and sequencing ofhLNα4LG4-5 module cDNA sequence Total RNA was prepared from placenta by Trizol reagent, and a specific cDNA fragment of hLNα 4LG4-5 module was obtained by RT-PCR. Primers used were GTCAGAATTCCCACC TTTCCAACAGCCCTAGAG for the 5'-end and GTCACTCGAGCTAGGCTGCTGGA CAGGAGTTGAT for the 3'-end and they were designed with DNASIS software. The cDNA fragment of LG4-5 was ligated with pMD18-T vector and transfered into competent cells (JM109). Plasmid was isolated from recombinant clones by alkaline lysis and sequenced confirmed by restriction digests and PCR amplification. Sequence comparing between LG4-5 module and hLN a 4 of GENBANK showed that the homogeneity was 99.8% (1098bp) and mutations occurred in 2 sites (T to C at 399 and T to C at 519), but the amino acids remained the same. So the cDNA sequence of hLN a 4LG4-5 module has been cloned and recombinant pMD-18T-LG4-5 vector was constructed successfully.Prokaryotic Expression of hLNα4LG4-5 module and antibody preparation pMD-18T-LG4-5 and pET-28a plasmids were digested with EcoR I and Xho I respectively, and the prokaryotic expression vectors pET-28a-LG4-5 was constructed by recombination of these restriction fragments. Recombinant pET-28a-LG4-5 plasmid was transferred into BL21(DE3) competent cells and the LG4-5 module protein was expressed as inclusion bodies after induced by IPTG. Inclusion bodies of LG4-5 were prepared and purified from BL21(DE3) expression strain and they were used to immunize rabbits as antigen. Hightiter (1:10240) polyclonal antiserum of LG4-5 module was isolated from the immunized rabbits. The protein of hLNα4 LG3-4 module expressed by E.coli BL21(DE3) was detected by Western blot in which the polyclonal antiserum of LG4-5 module was used as the first antibody.Expression ofhLNα4 LG4-5 module in 293 cell Nhe I and Xho I restriction sites were introduced to the LG4-5 module cDNA gene through new primers and PCR amplification. Eukaryotic expression vector pCEP-Pu/AC7-LG4-5 was constructed by subclone at Nhe I and Xho I sites. 293 cells were transfected with recombinant pCEP-Pu/AC7-LG4-5 plasmid by means of liposome and calcium phosphate respectively. Stable transfectants were obtained by selecting with G418 and puromycin. 293 cells and supernatant were collected and concentrated from stable transfectants respectively. RT-PCR amplification, ELISA assay and Western Blot showed the LG4-5 module was expressed in transfected 293 cells and was secreted into the medium successfully.Expression ofhLN α 4 LG4-5 module in Pichia yeast The yeast expression vector pPICZ α A-LG4-5 containing one copy of LG4-5 gene was constructed with the same method as pCEP-Pu/AC7-LG4-5. And the recombinants containing 2 and 4 copies of LG4-5 gene were constructed through Bgl II and BamH I restriction sites, which have the same ends after digestion. The recombinant plasmids containing LG4-5 module gene was transfered into Pichia yeast compete...
Keywords/Search Tags:Laminin, LG4-5 module, Clone, Expression, polyclonal antibody, 293 cells, Pichia yeast
Related items