Promoter is a very important element for regulating gene's expression. It is also a key component of genetic engineering vector. Some genes can only express in a specific tissue, which depends on the tissue specific promoters. The tissue specific promoter's tagging, testing and isolation methods are studied. Non-promoter strategy to label tissue specific promoter is certified as an effective promoter tagging approach. A non-promoter plasmid with UidA gene was transformed into Tritordeum embryos by bombardment. By analysing the transformed plants, anther primordea, pollen grain, and short cell specific promoters were certified to be labelled by UidA gene.The UidA gene labeled Tritordeum strains have been analysied by using X-gluc to test the expression of UidA gene. By strict detection of GUS activities in different parts of target materials, including root, stem, leaves, flower (glume,Lemma,palea,lodicule,awn,anther primordial, carpel,pollen), some transgenic strains were obtained, and their inheritance also studied in their offsprings. By 5 generation's genetic analysis and RT-PCR to study the transcription of UidA, several materials labeled with anther primordial, pollen, short cell tissue specific promoters and inner ubiquitious promoter were selected for promoter isolation.A simple PCR method was chosen to isolate the promoters. Using total DNA extracted from leaves of each different strains as template, rice anther specific promoter'primer(P1:5′CACGTAGTTCAATTACAGTTC3′) was used as 5'primer, 3'primer (P2:5′ACACA AACGG TGATACGTACACT3′) is a part of UidA gene,then the sequence including the tissue specific promoter was obtained by PCR reaction. By sequencing and characterizing the target DNA fragment, which contains a part of UidA gene and a flanking sequence, especially some essential promoter elements were found in this sequence. This 667bp DNA fragment containing anther specific promoter was cloned into pGEM-promoter1 vector.A method using alkaline phosphatase to label DNA as probe has been studied and used to detect the HBV DNA in hepatitis patient's serum and UidA gene in transgenic plants. The modified phosphatase was covalently linked to single stranded DNA using glutraldehyde. Such single stranded DNA enzyme complexes have been tested for blot hybridization and Southern blot, after hybridization and incubation with a substrate solution, result can be visualized directly in one hour. It is a sensitive, specific, rapid, safe and economical probe labeling and detection method.An efficient plasmid preparation and bacterium transformation system has been established. Three different kinds of bacteria (XL1 blue, TG1 and DH5α) have been tested. Each bacterial strain has its best condition depending on its growth curve. The storage time of competent cell and its correlation to transformation rate has been studied. The three crucial alterations to previous methods are the changing of the TB solution to normal CaCl2 solution, the changing of the medium from LB to S.O.C, and addition of DMSO or PEG8000 into transformation system. Improved bacterium transformation system can raise the transformation rate sharply. |