As a prevalent clinic symptom of many cardiovascular diseases, cardiac hypertrophy is intensively related with the morbidity of heart failure, atherosclerosis and stroke. Recently, isolation of disease related genes becomes an important field in revealing the pathogenesis of various diseases, samely, studies on related genes of cardiac hypertrophy can also bring us useful clue in prevention and therapeutics of cardiac hypertrophy and related diseases. Here we use the method of subtractive hybridization to isolate genes expressing differently during cardiac hypertrophy and discuss on the molecular mechanisms of cardiac hypertrophy.Methods: Firstly we established rat models of left ventricular hypertrophy by abdominal arota constriction(healthy Wistar rat, body weight about 200g); then prepared the experimental materials in different period after surgery (one day , three days, and four weeks after surgery) by directly cutting off left ventricular myocardium or isolating left ventricular cardiomyocytes with in-vitro heart perfusion; RNA extraction and cDNA synthesis are carried out as routine procedure; subtractive hybridization is performed after cDNA ligated with synthesized linker (linker sequences: 5' >ctcttgcttgaattcggact 3' ; 5' >agtccgaattcaagcaa<3' ) . After 4-5 rounds of subtractive hybridization, the left cDNA segments were digested with EcoRI and inserted into vector pBluescript-KS , and then transfected competent host JM109, so the subtractive libraries were constructed. After colony and dot hybridizations probed with subtracted cDNA and primary cDNA respectively, the candidate clones were selected according to their different signal intensity in hybridization with different probes, their sequences were sequenced and compared with known genes or sequences in GenBank.Result: we isolate total 36 differently expressed cDNA segments during cardiac hypertrophy identified by colony and dot hybridization. There are twenty four segments from myocardium and twelve from cardiomyocytes. Sequence homogenous comparing shows that six segments are much similar to rat cytochrome b gene (about 95%) and partially similar with skeletal muscle alpha actin gene (over 80%) and PLC21 gene (over 85%) and EPGF precursor gene (over 80%);they are differently expressed in different period during cardiac hypertrophy in pressure-overloaded rat. Another segment is very similar to ribonucleotide reductase M2 gene (over 90%). Also there is a segment very similar to a function-unknown gene (over 90%). Some others have...
|