Study Of Differentially Expressed Genes During The Closing Of Neural Tube In Mouse Brain Region

Neurulation is an important stage in the embryo development of vertebrate, during which the ectoderm thickens into epidermal neural plate and then forms neural folds and neural tube. The closing of neural tube is essential for the normal development of the brain and the spinal cord. The failure of the closure will lead to neural tube defects (NTD), which is a prevalent cause of perinatal deaths, secondary to congenital heart disease.Gene sequential differential expression determines cell differentiation and morphogenesis. In order to study the molecular mechanisms of neurulation and NTD development, it's important to investigate the differentially expressed genes during neural tube closing in mouse embryo. 1. Isolation of differentially expressed genes from the cranial region ofthe 9 day mouse embryomRNA differential display is a useful method to clone differentially expressed genes. Genes expressed specifically during the closing of neural tube in 9 day mouse embryo were isolated by silver-staining mRNA differential display, with 7 day whole embryo, brains of 13 and 18 day embryos of 615 mouse as contrasts. Modified mRNA differential display with optimized primers were used: 1) using two pairs of primers with elongated sequences—CGAATTCCGT₁₃C, TCGAATTCCGTACAACGA GG; ACGACTCACTATAGGGCT₁₂CG. ACAATTTCACACAGGAGACC ATTGCA. 2) After reverse trascription by T12CG, each of five 10mer arbitrary primers was used to perform PCR. Our results showed that the silver-staining method speeds up the procedure significantly, produces clear bands on polyacrylamide gel and allows rapid and efficient recovery and purification of cDNA fragments.The cDNA first strands of the four stages labeled by biotin-14-dCTP...