| Loquat is an evergreen fruit tree native to China,which is favored by consumers because of its sour-sweet flavor and high nutritional value of fruit,and medicinal value of both fruits and leaves.However,with the increasing regional scale of loquat industry,the problems of diseases and insect pests are highlighted,which has become a major obstacle to farmers’increment.During 2016～2019,the field investigations of disease occurrence were carried out in major production areas in China and the phenomenon of"standing dead trees"caused by root rot disease draw our attention.Loquat root rot disease occurred to varying degrees in all producing areas investigated,especially in Fujian and Zhejiang province,and the rate of incidence was over 25%in seriously infected plots.Symptoms of the disease included yellowing and wilting of the leaves on the above-ground,rotting of the taproots and cracking and breaking of the lateral roots in the underground,and finally leading to defoliation and death.Because root rot disease is a soil-borne disease,it will miss the best timepoint for treatment after showing visible symptoms.At present,cultivating disease-resistant varieties or rotation is the most effective and environmentally-friendly way to control it on major crops.However,it is difficult to adopt crop rotation on perennial fruit trees and therefore the primary task for root rot disease resistance breeding is to identify the pathogens and infection characteristics.In view of the foregoing,the pathogens causing loquat root rot disease were identified through the traditional isolation and identification methods(morphology,polygenic association,pathogenicity analysis)and its growth characteristic were analyzed in this study;The protoplast genetic transformation system of pathogens established by PEG-mediated method were used to screen the GFP-labeled isolates with the same pathogenicity and stable expression as wild type isolates.And the GFP-labeled isolates were further to track the progress of colonization in loquat plants;the colonization detection system of the pathogens causing root rot disease was established by designing fluorescent quantitative specific primers and adopting real-time fluorescent quantitative PCR(q RT-PCR)technology;The changes of endogenous hormones content and the expression of genes related to hormone signaling pathway were analyzed using liquid chromatography-tandem mass spectrometry(LC-MS/MS),and q RT-PCR,respectively.The main researches and results are as follows:1.A total of 18 symptomatic root samples(90 sections)collected from Zhejiang,Fujian and Chongqing were conducted for tissue isolation.Based on the preliminary analysis of ITS sequences,it was found that the isolates belonged to Fusarium sp.and Trichoderma sp.,with the isolation frequencies of 89.02%and 10.98%,respectively,and Fusarium sp.was the dominant genus.According to Koch’s postulate,F.oxysporum and F.solani were further identified from the dominant genus,and Root1and Root2 were selected as representative isolates for morphological characteristics,phylogenetic tree construction and pathogenicity test.It showed that the hyphae were white villous on the upper side of colony and with pink or fuchsia pigment on the reverse side of Root1 when cultured on PDA for 7d.Macroconidia were moderately curved and slightly pointed at both ends,3～7 septa,microconidia were round or elliptical,areatus and transparent pycnidium were observed on infected leaves;The hyphae of Root 2 were white,woolly-cottony on the upper side and white to light yellow on the reverse side.Macroconidia were moderately curved,1～5 septa,microconidia were elliptical or kidney-shaped,and long cylindrical monophialides were observed at the base of hyphae branch.The phylogenetic tree based on contatenated ITS,EF1-αand RPB2 sequences showed that Root1 was gathered with Root3,Root6 obtained in this study and type isolate NRRL25387 belonging to F.oxysporum,Root2 was clustered with 4 reference isolates belonging to F.solani obtained from different databases in the same branch.The outgroup isolates formed a separate branch.Most of the values at nodes indicating Bayesian posterior probabilities and bootstrap support were higher that 80%which showed that the phylogenetic tree could reflect the genetic relationship of each isolates;The pathogenicity test conducted by in vitro wounded leave inoculation and in vivo wounded root inoculation showed that inoculation of Root and Root2 could cause disease with consistent syptoms observed in field syptoms,the re-isolated pathogen from diseased plants was identical to the isolates used for pathogenicity test through morphology,molecular identification.It indicated that F.oxysporum and F.solani were the pathogens causing root rot disease on loquat;The biological characteristics analysis showed that the the optimal temperature for the hypha growth of F.oxysporum was 25～30℃,and the optimal temperature of F.solani was 30℃.Both F.oxysporum and F.solani can grow under a range p H5～10;The optimal carbon source for F.oxysporum was starch and the optimal nitrogen source was potassium nitrate;The optimal carbon source for F.solani mycelial growth was glucose and the optimal nitrogen source was yeast extract.2.A PEG-mediated protoplast genetic transformation system of loquat root rot pathogens was construced and used for introducing GFP into F.oxysporum isolate Root1 and F.solani isolate Root2.The transformants with high fluorescence intensity,stable characteristics,consistent growth rate,pathogenicity and colony morphology with wild-type isolates were selected for subsequent real-time observation during the infection progress through a series of assay including fluorescence and hygromycin resistance assessment and PCR verification of hph and gfp inserted into the transformant.3.The infection progress of the GFP-labeled isolates were observed using fluorescent microscope.It showed that the condia invaded from the root of the plant after germination and expanded along the intercellular space in the stele of the root at1～2 dpi(days post-inoculation),the hyphae reached the vascular system at the base of the root and stem at 3～4 dpi.The main infection site of F.oxysporum was in the xylem of stem and hyphae expanded inward and outward from the xylem to the whole stem.The infection site of F.oxysporum was in the stem epidermis and xylem.At 5～7dpi,the amount of hypha at the stem base of the plant was increased,and the hypha growth trace was found in the main vein of the leaf.The hypha expanded along the main vein to the lateral vein,and to the whole leaf,finally infected the whole plant.4.In total of 14 and 15 pairs of fluorescent quantitative primers for F.oxysporum and F.solani respectively were designed based on six genes(18S r DNA,EF1-α,β-tubulin,ITS,RPB2,CAL).A pair of specific fluorescent quantitative primers were obtained according to the calmodulin gene sequences of F.oxysporum which were R1-F:CTTAAATCGAAAACATGGCTAAACGC and R1-R:ACTGACCGTCCTCTA ATCG TCTTGG.The size of amplification product was 148 bp.The sensitivity of it was 100 times higher than that of the conventional PCR.The recombinant plasmid inserted target fragment was used for establishing the optimal system and drawing the standard curve of SYBR Green I based q RT-PCR.The regression equation was y=-1.1396x+63.912 and the correlation coefficient R~2was 0.98 which gave a realistc linear relationship.The copy number could be obtained when substituting the Ct value of the sample into the regression equation.The colonization of F.oxysporum in different tissues of healthy loquat plants was detected by inoculating with bacterial infusion solution.The results showed that the content of F.oxysporum was increased significantly in the root at 7 dpi.The content of pathogens climed up and then declined with time.5.The content changes of 14 hormones belonging to 4 major plant hormones which are salicylic acid(SA),jasmonic acid(JA),abscisic acid(ABA)and gibberellin(GA)and the expression of genes related to hormone anabolism and signal transduction before and after inoculated by F.oxysporum Root1 and F.solani Root2were measured using liquid chromatography-tandem mass spectrometry(LC-MS/MS)and q RT-PCR,respectively.It showed that the content of SAG and JA-ILE were extremely different after inoculation(p<0.05),and the content of JA showed a significant difference after inoculation(p<0.1),while the differences of the other hormones were not significant.The SAG content was up-regulated and JA-ILE&JA content was down-regulated by Fusarium sp.infection.The trend of hormone anabolism-related genes expression was consistent with that of hormones content,and the expression of disease resistance-related genes showed a close relationship with them.Therefore,Fusarium infection mainly induced the systemic defense response of the SA signaling pathway and inhibited the defense response of the JA signaling pathway.It was suggested that SA mediated systemic acquired resistance(SAR)might be a key pathway involving the mechanism of Fusarium induced resistance in loquat... |
PDF Full Text Request