| With the tropical marine monsoon climate,the coastal waters from Sanya to Lingshui are popular destinations to develop tropical agriculture,tourism and tropical marine fisheries;and at the same time,aquaculture wastewater,domestic sewage and agricultural wastewater are discharged into the coastal waters,which had caused serious eutrophication in partial coastal waters,and toxic dinoflagellates are likely to grow massively in a short time,threaten to marine ecosystems,marine environment and public health,establishing rapid identification and detection methods of toxic dinoflagellate is extremely important in marine environmental monitoring.A total of 67 dinoflagellate species in 21 generas,14 families,5 orders are found in the coastal waters from Sanya to Lingshui,most of them are Peridiniales and Gonyaulacales,and the proportion is 76.1%;and a total of 27 red tide-forming species and 12 toxic species are found.Using cluster analysis method to analyze the distribution of 12 toxic dinoflagellate species,the results show that,in the coastal waters from Sanya to Lingshui,the common toxic dinoflagellates are Alexandrium tamarense,Prorocentrum lima,Karenia mikimotoi,Heterocapsa circularisquama,Karlodinium veneficum and Prorocentrum minimum;In view of A.tamarense has the characteristics of wide distribution,high toxicity and red tides occur frequently in warmer seas,moreover,suitable climate and developed fisheries in Sanya and Lingshui;real-time fluorescence quantitative PCR provides a reliable technology for the detection of dinoflagellates,in this study,A.tamarense is selected as the research object to establish a real-time fluorescence quantitative PCR detection method.Using f/2 medium solution,culture of A.tamarense under the temperature of 23℃,the salinity of 30±2‰,the light-dark ratio of 12:12 and the light intensity of 4000-6000lux,and the current density has reached 4.3×10~5 cells/m L.In order to design specific primers for A.tamarense,this study obtained DNA sequences of A.tamarense,Chlorella vulgaris,Synechococcus sp.,Alexandrium species and some common dinoflagellate species from Genbank,the sequence comparison analysis found that,the 28S r DNA region of A.tamarense has low sequence similarity to the others,so the primers were designed by Primer designer 6.0with 28S r DNA as specific region.A.tamarense 28S-F:tgatagcacacaagtaccatgagg,gene loci:281-304;A.tamarense 28S-R:caacactcccaccaagcaaa,gene loci:378-397.In order to verify the specificity of A.tamarense 28S(F/R),phytoplankton DNA samples are amplified by ordinary PCR and SYBR Green real-time fluorescence quantitative PCR.The results show that,A.tamarense 28S(F/R)only amplify the samples which containing A.tamarense DNA,and the melting curve of SYBR Green real-time fluorescence quantitative PCR is a single peak,so,it can be concluded that A.tamarense 28S(F/R)is specific to A.tamarense.In order to establish the SYBR Green real-time fluorescence quantitative PCR method for detecting A.tamarense in water environment,the different dilution ratio of DNA samples are amplified by SYBR Green real-time fluorescence quantitative PCR,and the quantitative counting standard curve is y=-3.392x+42.412,in theory,the sample contains 6 A.tamarense cells can be detected.Using SYBR Green real-time fluorescence quantitative PCR to detect the sample with known A.tamarense cell quantity,the results show that,this method is 4.9×10~5cells/m L,microscopic counting method is 4.3×10~5cells/m L,the error is 14.0%,less than the allowable error of plankton survey(20%),this method is proved to be reliable.Using SYBR Green real-time fluorescence quantitative PCR to detect A.tamarense from the coastal waters of Sanya Bay,this method is 1000cells/m L,microscopic counting method is 850cells/m L,the error is 17.6%(<20%),which proved this method has strong specificity,high sensitivity,and certain practical application value,can be provide technical support for A.tamarense monitoring. |