Ticks are an important zoonotic parasite,which can transmit a large number of pathogens and do great harm to animal husbandry.Mitochondria has the function of self-transcription and translation,and its highly conserved genomes are helpful to analyze species specificity,genetic diversity and ecological regionalism.The rearrangement of tick mitochondrial genome related to its phylogeny and gene function.Phylogenetic analysis of mitochondrial genomes has solved the classification of many controversial genera and species in ticks.By the end of March2022,NCBI had published the complete mitochondrial genomes of 88 tick species belonging to 15 genera and 3 families,accounting for only 9.2%of the total tick species.At present,the mitochondrial genome data of some important populations have not been obtained,which leads to the monogenic problem of The genus Dermacentor and Haemaphysalis,and the division of the genus and subgenus of the family Argasidae.In addition,accurate annotation of mitochondrial genome can provide more genetic information on the basis of obtaining accurate sequence,which is of great significance in revealing the mechanism of transcriptional regulation and genetic variation of mitochondrial genome.In this study,the full-length mitochondrial genomes of D.nuttalli and D.marginatus were obtained by high-throughput sequencing of long-fragment PCR amplification products,and the two mitochondrial genomes were accurately annotated to 1bp combined with high-throughput sequencing data of small RNA.In addition,based on the previous finding that a transposon like element exists in the mitochondrial genome of D.silvarum,the tandem repeat(TR)of D.nuttalli,D.marginatus,D.niveus,D.silvarum,from different regions were further amplified,and the sequence characteristics and nucleotide polymorphisms of the large translocated segment(LTS)in which it resided were analyzed.Main conclusions are as follows:1.The full length mitochondrial genome of D.marginatus was obtained with the size of 15225bp.The full-length mitochondrial genome of D.nuttalli was obtained with the size of 14986bp.For the first time,the above two mitochondrial genomes were accurately annotated to 1bp,that is,each base in the mitochondrial genome has its own attribution.These results provided detail data support for further studies on the regulatory mechanism,genetic variation and phylogenetic analysis of the mitochondrial genomes of D.nuttalli and D.marginatus.2.The accurately annotated TR2,ND1,t RNALeu,16S r RNA,t RNAVal,12S r RNA,CR1,t RNAIle,t RNAGlnand TR1 of the mitochondrial genomes of D.nuttalli and D.marginatus were LTS,in which TR1 and TR2 were similar to reverse repeat sequences(Irs)of transposons,the two were mutually complementary sequences,whereas the gene from ND1 to t RNAGlnwas similar to insertion sequence(Iss).3.It was found that the repeat units and repeat times of TR1 and TR2 were different among different tick species,while the repeat units of the same tick species tended to be the same in different geographical populations,but the repeat times were different.Generally speaking,the number of TR2 repeats in the same tick was equal to or greater than TR1.The genus Dermacentor contains TR2 and TR1,while the genus Rhipicentor contains only TR1.Palaearctic distribution of leather tick repeat units of 44 nt TTTGCATCATTTTTTGGAATTAAAACTCAATCTTTTTAATTTTA highest selectivity,repeat number was less than 8 times,with no obvious rule but generally preferred to choose 4 and a half times.For all repeat units in the genus Dermacentor,the posterior 21nt is shared.4.Further studies found that TR did not change with gender,and the offspring of the same mother were completely consistent with TR.At present,it is not clear why the polymorphism of TR is affected,and the reason might be DNA recombination.In conclusion,PCR amplification combined with High-throughput sequencing is a reliable and relatively fast method to obtain the full length of tick mitochondrial genome and annotate it accurately.In addition,the specific function of TR in LTS and the evolution of TR in different tick species need further study. |