Gene expression regulation is a hot spot in modern molecular biology and the posttranscriptional regulation has attracted great concerns of researchers with the development of technology.RNA Binding proteins(RBPs),as an important post-transcriptional regulator,play an essential role in RNA alternative splicing,RNA stability,translation,and so on,which affect multiple growth processes such as flowering,biotic and abiotic stress.Erb B3 binding protein(EBP1)is an RBP with highly conserved structure and functions,which involved in the regulation of ribosome biogenesis and protein translation through binding a variety of RNAs such as r RNA,t RNA,and m RNA.However,few of RNA targets of EBP1 have been documented and the mechanism of interaction with its RNA target are still unknown.It is reported that RALF1-FER signal promotes the accumulation of EBP1 protein and affects the binding of EBP1 to downstream target gene promoters.It is still unknown whether RALF1-FER signal regulates the binding ability of EBP1 to RNA.Our results confirmed that Arabidopsis EBP1 had the function of binding RNA,and regulated the post-transcriptional events of target RNAs by RALF1-FER signals,which provided useful data for further studying the biological mechanism of EBP1 post-transcriptional regulation.The specific results are as follows:(1)The Arabidopsis RALF1 and EBP1 CDS fragments were successfully constructed into p ET-28 a and p GEX-4T-1 protein expression vectors.The optimal conditions for inducing RALF1 and EBP1 proteins were obtained at 28? / 6 h and 28? / 4 h,a single fusion protein with a higher concentration was expressed.(2)The Pfam website predicted the primary domain of Arabidopsis EBP1,and found that EBP1 contains a conserved domain that binds RNA at 48-56 amino acids.By comparing the three-dimensional structure of human and Arabidopsis EBP1,they will find that their structures are highly conserved and the 48-56 amino acid region is similar to the ?70-like motif sequence of the reported binding RNA.(3)Total RNA binding experiments confirmed that EBP1 can bind RNA in vitro.The RNA electrophoretic mobility shift assay showed that EBP1 can directly bind to the "GUCUCUCACUGCGACGGCUU" RNA sequence in vitro.(4)NCBI website found 12 EBP1 potential binding RNA sequences.m RNAs of three genes(AT1G24792,AT3G25211,AT3G24320)were identified in RNA immunoprecipitation assay.(5)Cordycepin treatment experiment showed that EBP1 significantly regulated the stability of AT1G24792 and AT3G25211 target m RNAs.Polysome profiling experiment showed that EBP1 inhibits the effects of AT1G24792 and AT3G24320 m RNA and ribosome,and promotes the effects of AT3G25211 m RNA and ribosome.(6)RNA immunoprecipitation experiments show that RALF1 promotes the binding of EBP1 to target RNA with RALF1 treatment.Further research on RALF1-FER signaling to regulate the post-transcriptional events of RNA involved in EBP1 found that in terms of RNA stability,RALF1 treatment accelerates the degradation of AT1G24792 and AT3G24320 m RNAs and has no effect on the stability of AT3G25211 m RNAs. |