Background:Tuberculosis causes about 1-2 million deaths worldwide every year,it is still a major threat to human health infectious diseases in this century.Although the infection rate and mortality rate have a certain downward trend,the overall medical burden is still very heavy.The early diagnosis of tuberculosis is of great significance for the treatment of tuberculosis and the control of the widespread spread of tuberculosis bacillus,Currently,the laboratory diagnosis of tuberculosis mainly relies on sputum smears,acid-fast staining,mycobacterium culture and nucleic acid amplification,However,all the methods have different disadvantages or are limited by the laboratory environment and equipment,so it is difficult to promote them comprehensively,Therefore,a new laboratory diagnostic method for TB is urgently needed to realize a more efficient screening strategy.With the further development of the whole genome sequencing of mycobacterium tuberculosis,in addition to the traditional molecular markers such as 16SrRNA,23SrRNA,IS6110,rpoB and mtp40,the newly discovered molecular targets and the improvement of molecular biological methods can be used to construct and detect mycobacterium tuberculosis stably.Objective:Mts90 is a newly discovered molecular target of human mycobacterium tuberculosis,but the detection of mts90 is difficult to carry out routinely in clinical practice.This study aims to establish a mts90 detection method with high sensitivity and specificity,simple detection procedure,and more suitable for practical clinical use.At the same time,clinical specimens of tuberculosis infection were collected in a standardized way to explore the clinical application value of the newly constructed test method for tuberculosis.Methods:The molecular target mts90 of M.tuberculosis was amplified by recombinant polymerase amplification(RPA).The secondary structure of all primers and probes was tested and the first round of detection was performed to screen for the optimal primer sequence.The constructed mts90 plasmid standard was serially diluted into 8 copies?8×10~1copies?8×10~2copies?8×10~3copies?8×10~4copies?8×10~5copies, respectively,and the sensitivity of the mts90 RPA assay was analyzed.Mts90 plasmid was used as a positive control,with three types of Mycobacterium tuberculosis strains ATCC27294(human type),CMCC95049(Mycobacterium tuberculosis),CMCC95006(gastrointestinal type)and common respiratory pathogens such as Streptococcus pneumoniae,hemolytic chain Cocci,Staphylococcus aureus,etc.are used as templates to extract genomic DNA of all pathogens.Comparative analysis of the diagnostic performance of the mts90 RPA method and the PCR method.A total of 70 patients with tuberculosis admitted from June 2018 to February 2019 were tested with acid-fast staining method,mycobacterium tuberculosis culture method,PCR-fluorescent probe method and mts90 RPA method,respectively,to evaluate the clinical application value of mts90 RPA,a new target of mycobacterium tuberculosis.Results:(1)Western-blot detection showed that the amplification effect of primer F3/R7(CCTCTGACCAGGCGACATAGACAACAGTACCC/CACGCGGCCGTCGG GGCCGGTGTAGCTGGCTTGCC)was the most obvious.The probe(CAGAGCATAGACACGATCTTGGAAGGTTTCAGT(THF)AAC(BHQ-dT) CCGTGGCGTGTCTCTTATTG-Spacer)The protein expression of the reaction product of the screening primer is most obvious.Can be used for further experiments.(2)When the concentration of the dilution of the mts90 plasmid standard is between 8×10~0 and 8×10~5copies,the plasmid can obtain a significant amplification signal,and the amplification fluorescence signal becomes more obvious as the concentration increases.In order to avoid the contingency of the reaction,we performed at least 3 repeated tests on each concentration of the diluted solution,and all of them obtained a positive reaction.At about 10 minutes,a significant amplification signal appeared,and the reaction time was significantly negatively correlated with the template concentration.(3)RPA detection showed that only the ATCC27294 strain showed a positive amplification signal,while other strains,including CMCC95049(M.tuberculosis)and CMCC95006(gastrointestinal type),did not observe amplification signals.Agarose electrophoresis detection revealed the same trend as the PCR reaction.This indicates that mts90 RPA has a high specificity.(4)We compared and analyzed the detection performance of mts90 RPA method with the other three most commonly used detection methods,and found that the positive rate of mts90 RPA method was significantly higher than that of sputum smear acid-resistant staining microscopy method(chi-square value was 12.919,P<0.01),and there was no significant difference between mts90 RPA method and tuberculosis culture method and pcr-fluorescence probe method(P>0.05).The average detection time of mts90 RPA and PCR was 11.9min,28.4min,and the maximum detection time was 19.6min and 75min,respectively.This indicates that the specificity and sensitivity of the two detection methods are close to each other and can be replaced to a certain extent.However,mts90 RPA method has a significantly shorter detection time,simple operation steps and more operational advantages.Conclusion:Mycobacterium tuberculosis new targets mts90 RPA detection method compared with traditional sputum smears,acid-fast staining microscopic examination and mycobacterium culture method has higher sensitivity,compared with traditional PCR method,its operation more simple,the reaction time is shorter,because the method of experimental environment and condition request is not high,so more suitable for popularization in grassroots medical institutions,offers a new screening tool for early diagnosis of TB. |