| ObjectiveThe pathogenesis of steroid resistant nephrotic syndrome(SRNS)in children is complex.Podocyte gene mutation is one of the more clear mechanisms at present,and some children with podocyte gene mutation respond to immunosuppressive therapy,Therefore,this study will summarize and analyze the clinical data of children with SRNS gene mutation,to provide a reference for early clinical diagnosis and precise treatment.In addition,The clinical treatment of children with SRNS is difficult at present,and often requiring combined immunosuppressive therapy,Cyclophosphamide(CTX)is one of the traditional immunosuppressants,Because of its strong immunosuppressive effect and low price,it is widely used in the treatment of frequently relapse nephritic syndrome(FRNS),However,the exact efficacy and safety of SRNS are still controversial,Therefore,this study applied statistical methods to analyze the clinical efficacy of high-dose CTX intravenous shock treatment of children with SRNS,to provide theoretical basis for clinical medication.MethodsA retrospective study,The study object was children who were hospitalized in the kidney Department of Xi’an children’s Hospital from January 2012 to January2019,Collected clinical data of 31 children with SRNS who had received high-dose CTX shock therapy and 4 children with SRNS who had gene mutations(Not included in the above 31 children),to analyze the clinical efficacy of CTX,and explore the clinical features of children with genetic mutation SRNS Results1.The effect of high-dose CTX shock in children with SRNS:(1)Age of onset,gender,clinical and pathological classification: The age of onset was 1.17 to 12.75 years old,the ratio of male to female is 2.1:1,Simple nephropathy accounts for 64.5%,and nephritis nephropathy accounts for 35.5%;28 of 31 children with SRNS underwent renal pathological biopsy,pathological types: Of these,8 cases(28.6%)were minimal change diseas(MCD),13 cases(46.4%)were mesangial proliferative glomerulonephritis(MSPGN),4 cases(14.3%)were focal segmental glomerulosclerosis(FSGS),1 case(3.6%)was membranous nephropathy(MN),and 2 cases(7.1%)were endocapillary proliferative glomerulonephritis(EPGN).(2)Among the 31 children with SRNS who receivedCTX treatment,12 had negative proteinuria,4 had urinary protein turning negative after 2 courses,3 had urinary protein turning negative after 3 courses,and 4 had urinary protein turning negative after 4 courses.In 2 cases,there were 1 case of urinary protein turning negative after 5 courses,and 2 cases of urinary protein turning negative after 6 courses.(3)After the high-dose CTX treatment,Among the31 cases,12 cases were completely remission,9 cases were partial remission,10 cases were ineffective,and the overall effective rate was 67.7%.The effective rate of simple nephropathy was 65%,and the effective rate of nephritis was 72.7%.There was no significant difference between these groups(P>0.05);Remissions of different pathological types:6 of the 8 patients with pathological type MCD had remission,4 patients with pathological type FSGS had remission,9 of 13 patients with pathological type MSPGN had remission,and 2 patients with pathological type EPGN had remission,one patient with pathological type MN was not relieved.(4)adverse reactions: Gastrointestinal reactions and liver damage were common,and the incidence of adverse reactions was 23%.2.Study on gene mutation in children with SRNS:(1)General data of 4children with SRNS with gene mutation:1.9-8.7 years old,male to female ratio is3:1,mainly simple nephropathy accounts(3/4cases).3 of 4 children with SRNS underwent renal pathological biopsy:3 cases were FSGS,1case had no renal puncture.(2)Gene mutation:1 case had WT1 gene mutation: c.1384C>T(p.R462W)in exon 9,which was a missense mutation and belongs to a newborn mutation;1 case had COL4A5 gene mutation: c.2078G>A(p.gly693glu)in exon 27,which was a missense mutation.The mutation originated from the mother,and the mutation site of the father,mother and sister of the patient was verified.It was found that the mother and sister had a heterozygous mutation at the same site,combined with the characteristics of the child’s medical history and genetic report,and finally diagnosed as Alport syndrome;1 case had LAMB2 gene mutation: c.4370gG>A(p.R1457Q)in exon 27、C.3325gG> A(p.E1109K)in exon 22,both of which are missense mutations,the former comes from Mother,the latter comes from father;SMARCALL gene mutation was found in 1 case: c.1334 + 1G > A shear mutation in intron 7,c.2303-c.2327delGCCAGCAGTTCCAACTGTCGGAGAG(p.C768Cfs*36)in exon 15,The former is a shear mutation,derived from the mother,and the latter is a frame-shift mutation,derived from the father.Combining the characteristics of the child’s medical history and genetic report,the final diagnosis is Schimke immune-bone dysplasia(SIOD).(3)Follow up: The follow-up period was(2.3±0.7)years,One patient with LAMB2 gene mutation has been lost to follow-up,One patient with WT1 gene mutation died of renal failure and refractory hypertension in the third year of the disease.One patient with mutations in the SMARTACAL1 gene developed renal failure at the end of the first year of the course of the disease.They gave up treatment in the second year of the course of the disease,and eventually died at home due to worsening renal failure.One patient with COL4A5 mutation is currently in stable condition and is still being followed up.Conclusions1.High-dose CTX shock therapy for children with SRNS has a relatively early onset time,significant short-term efficacy,good safety,and low price.As one of the traditional immunosuppressive agents,CTX can still be used as a first-line treatment for children with SRNS.2.In order to avoiding overuse of hormone and immunosuppressant,gene diagnosis should be carried out as early as possible in children with SRNS,at the same time,It is beneficial to early clinical diagnosis,treatment guidance and prognosis prediction. |