Preliminary Study Of Effects Of NRAGE On Proliferation And Odontoblastic Differentiation Of Mouse Dental Pulp Cells

NRAGE is firstly identified as a molecule interacting with low affinity nerve growth factor receptor p75NTR.According to previous studies,NRAGE modulates the function of Dlx/Msx to promote myogenic differentiation.A strong signal for NRAGE mRNA was also found in cell layers surrounding cartilaginous elements in bone rudiment during digit formation in embryogenesis,and a further study proved that NRAGE may act as a regulator of Dlx family members in bone formation.Dlx3 also plays a key role in odontoblast polarization and dentin formation.NRAGE participates in activating the non-canonical and alter-native bone morphogenetic protein(BMP)signaling pathways.Meanwhile,BMP signaling pathways play an important role in tooth development and regulating the proliferation and differentiation of DPCs.Odontoblasts and osteoblasts share many similarities.Therefore,we hypothesized that NRAGE may exert effects on mouse dental pulp cells(mDPCs)during tooth development.Objectives:1.Culture the primary mDPCs and perform odontoblastic induction to do correlational research.2.To investigate the influence of NRAGE on the proliferation and differentiation.3.To investigate the signaling pathways involved in NRAGE regulation of mDPCs differentiation.To investigate the influence of NRAGE on the differentiation.Materials and Methods:1.Isolation and culture of primary mDPCs.The primary cultured mDPCs were isolated from the incisors of healthy four-week-old mice.The pulp tissues were gently separated from the tooth and cut into small pieces(about 1 mm3)by ophthalmic scissors.The tissue pieces were cultured in high-glucose Dulbecco's modified Eagle's medium supplemented with 10%fetal bovine serum and antibiotics in a humidified atmosphere of 5%CO2 at 37?.When the cells reached confluence,the mDPCs were digested by trypsinization and cultured.Cell cultures between the third and sixth passages were used in the study and the culture medium was changed every 3 days.DMEM supplemented with 10%FBS,antibiotics,50 ?g/mL ascorbic acid,10 mmol/L sodium ?-glycerophosphate and 10 nmol/L dexamethasone was used as odontoblastic induction medium.mDPCs were plated in six-well plates at an initial density of 2×105 cells/well and then cultured in odontoblastic induction medium.2.Use lentivirus infection to establish the cellular model.Lentiviral plasmids carrying the small hairpin NRAGE interference(mDPC/shNRG),targeting the AAGATGAAAGTGCTGAGATTC sequence or nonspecific sequence(mDPC/shCon),were constructed using the vector pLKO.1-puro.In brief,shCon-plasmid and shRNA-plasmid cotransfection were performed using Lipofectamine 2000(Invitrogen)in accordance with the manufacturer's protocol.shNRG or shCon were packaged in 293T and infected mDPCs using polybrene(Sigma)for 24 h,then 2 ?g/ml puromycin(Sigma)was added to select the positive transfected cells for 4-7 d.3.Investigate the change of the ability of proliferation.After knocking down NRAGE,we perform RT-PCR and Western Blot experiment to validate it.We use CCK-8 assay to detect the change of the ability of proliferation.4.Investigate the change of the ability of differentiation and the potential signal pathway.After knocking down NRAGE,we perform odontoblastic induction.We use RT-PCR?Western Blot?ALP activity assay?mineralization and ALP staining experiment to detect the change of the ability of differentiation.Meanwhile,we use Western Blot and immunofluorescence staining to explore the potential signal pathway.Results:1.During the odontoblastic induction of mDPCs,we found the expression of NRAGE gradual decline.During the induction,the mRNA and protein levels of DMP1,DSPP,ALP were increased,this mean the odontoblastic induction is success.By contrast,the mRNA and protein levels of NRAGE were down-regulated during odontoblastic differentiation,this indicates that NRAGE may have inhibiting effect to odontoblastic differentiation.2.Knocking down NRAGE,cause the ability of proliferation to weaken.After stable knockdown of NRAGE in mDPCs by lentivirus,we find the proliferation rate of NRAGE-depleted mDPCs was much slower than that of the mDPCs/wt and mDPC/shCon groups(P<0.01)on different time among induction,This indicated that the cell growth of NRAGE-depleted mDPCs was greatly inhibited.3.Knocking down NRAGE,cause the ability of differentiation to enhance.After stable knockdown of NRAGE in mDPCs by lentivirus,the amount of mineralized nodules formed in the mDPC/shNRG group on 14 d was significantly higher than that in the mDPC/wt and mDPC/shCon groups.ALP staining showed the same trend as mineralization in the three groups.We also find that the levels of DMP1,DSPP and ALP were significantly higher in the mDPC/shNRG group than those in the mDPC/wt and mDPC/shCon groups,and the different is increase as induce time goes on.These results indicated that knockdown of NRAGE promoted the odontoblastic differentiation of mDPCs.4.NRAGE affect the odontoblastic induction of mDPCs may through NF-?B signal pathway.After stable knockdown of NRAGE in mDPCs by lentivirus,among the induction,Western Blot analysis showed NF-?B/p105 was down-regulated in the mDPC/shNRG group,while NF-?B/p50 was up-regulated,the results in the mDPC/wt and mDPC/shCon groups is not significant.Moreover,in the mDPC/wt,immunofluorescence staining showed that while NRAGE was located homogeneously in the nucleus and cytoplasm,it gradually translocated towards the nucleus among induce.Meanwhile,NF-?B translocated from the cytoplasm into the nucleus of mDPCs during the same process.Moreover,the locations of NRAGE and NF-?B were almost the same after induce for 14 d.These results suggested that NRAGE possibly regulated the odontoblastic differentiation of mDPCs via the NF-?B signaling pathway.Conclusion:The mRNA and protein levels of NRAGE decreased significantly after odontoblastic induction of mDPCs.Knockdown of NRAGE inhibited the proliferation of mDPCs.However,knockdown of NRAGE enhanced odontoblastic differentiation of mDPCs with up-regulated ALPase activity.It also promoted mineralization nodule formation as well as the mRNA and protein expressions of ALP,DSPP and DMP1.The protein levels of NF-?B/p50 significantly increased,whereas NF-?B/p105 protein expression decreased in the mDPC/shNRG group.Immunofluorescence staining showed that the relocation of NF-?B was almost similar to that of NRAGE during odontoblastic induction.NRAGE and NF-?B translocated from the cytoplasm into the nucleus during this processNRAGE is a potent regulator for proliferation and odontoblastic differentiation of mDPCs,which maybe though the NF-?B signaling pathway.