Objective: The developmental abnormality of Enteric nervous system(ENS)is one of the most common digestive tract malformations in childhood,and its regulation mechanism is still unclear.In the previous transcriptome sequencing results of our group,cerebellar degeneration-related ptotein 1 antisese(CDR1as)was differentially expressed.CDR1 as is a circular RNA formed by cyclization of the 3'-5' phosphate bond by reverse splicing of the CDR1 gene exon.Studies on circular RNA CDR1 as have focused on diseases such as tumors and metabolism,and studies on the development of the intestinal nervous system have not been reported.Therefore,this study first verified the sequencing results by CDR1 as RT-PCR.According to the results of this experiment,using rat intestinal neural crest stem cells,through functional experiments such as cell proliferation(CCK-8 method),apoptosis(AV-PI method),and cell migration(Transwell),to explore the role of CDR1 as in the development of the enteric nervous system.methods: 1.Expression of CDR1 as in the intestine of patients with Hirschsprung's disease.In the collection,the congenital megacolon was discarded as the case group,and the normal segment was used as the control group.The expression of CDR1 as was observed by q RT-PCR.2.Using human homologous sequence analysis,PCR,agarose DNA electrophoresis,cloning and sequencing,the rat CDR1 as trans-splicing site sequence was obtained.The sh RNA was designed using this sequence to construct a rat CDR1 as Sh RNA adenovirus expression vector.3.Expression of CDR1 as in intestinal neural crest stem cells of rats with different gestational age(E10,E12,E14).4.Transfection of rat intestinal neural crest stem cells and extraction of secreted exosomes.The CDR1 as Sh RNA transfection group was used as the experimental group,and the empty adenovirus transfection group was used as the control group.Functional experiments such as cell proliferation(CCK-8),apoptosis(AV-PI),and cell migration(Transwell)were used to compare the differences between the two groups.5.rat neural crest(CDR1as knockdown)stem cell derived exosomes on normal neural crest stem cells,through cell proliferation(CCK-8),apoptosis(AV-PI),cell migration(Transwell),etc.Functional experiments comparing differences between the two groups.6.statistical analysis The experimental results are expressed as mean ± standard deviation,and the data was analyzed using Graph Pad Prism 7.Results: 1.Expression of CDR1 as in the intestine of patients with Hirschsprung's disease.The expression of CDR1 as was down-regulated in the sputum segment compared with the normal segment,and the difference was statistically significant.2.Rat circular RNA CDR1 as trans-splicing site sequence: TTGGAAGACCTTGGTACTGGCACCACTGGAAACCCCTGGATACGGCA GACACCAGAAAACCA 3.Expression of CDR1 as in intestinal neural crest stem cells of rats with different gestational age(E10,E12,E14)The expression of CDR1 as in E10 rat intestinal neural crest stem cells was significantly higher than E12 and E14.4.Cell proliferation(CCK-8 method),apoptosis(AV-PI method),and cell migration(Transwell).Comparison of rat intestinal neural crest stem cell transfection group and control group The CDR1 as Sh RNA group of rat intestinal neural crest stem cells was weaker than the control group,and the apoptosis increased and the migration ability decreased.5.cell proliferation(CCK-8 method),apoptosis(AV-PI method),cell migration(Transwell)to explore the role of rat neural crest(CDR1as knockdown)stem cell-derived exosomes on normal neural stem cells The exosomes secreted by the rat intestinal neural crest stem cells whose expression of CDR1 as is down-regulated have the effects of inhibiting proliferation,promoting apoptosis and inhibiting migration of normal rat neural crest stem cells.Conclusion:(I)Circular RNA CDR1 as may play an major action in the embryonic development of E10.(II)Down-regulation of circular RNA CDR1 as inhibits proliferation of rat intestinal neural crest stem cells,promotes apoptosis and inhibits migration.It suggests that CDR1 as plays an important regulatory role in the development of the enteric nervous system. |