The Clinical And Molecular Genetics Of A Chinese Family With Long QT Syndrome

Background:Long QT syndrome(LQTS)refers to a group of syndromes characterized by prolonged QT interval and abnormal T waves in the electrocardiogram,which are easy to produce arrhythmias dominated by TdP(torsadesde points),and then develop into malignant arrhythmias,causing syncope and sudden death.The disease is an autosomal genetic disorders,see more at teenagers,with early onset age,the characteristics of high mortality rates and more a familial disease,have an enormous effect to the patients' family and society,so the clinical and molecular genetic features of LQTS to its high level of the diagnosis and treatment of the disease,improve the prognosis of patients is of great significance.AIM:The clinical characteristics and molecular genetic characteristics of a family with long QT syndrome were analyzed,the pathogenic genes and mutation sites of the family were detected,and the genetic pattern and the relationship between genotype and phenotype were clarified.According to the genetic test results,the type of the family disease was determined,and targeted treatment was given.Methods:First discovered in the clinical work of the clinical symptoms with LQTS,collecting history of proband and their family members,and a detailed physical examination,record its clinical characteristics of cardiac symptoms,record the existence of congenital deafness,family genetic predispositions paroxysmal syncope and sudden death,etc.,the proband and his family members,the examination of the electrocardiogram(ecg),analyze the ecg characteristics;Peripheral venous blood collected subjects,extraction of genomic DNA,targeted enrichment of 12 genes associated with LQTS to the second generation sequencing,such as found a gene mutations,exons and splicing is using Sanger sequencing proof,not illness in the family members and 50 unrelated normal to detect the mutation,to eliminate single nucleotide polymorphisms.Bioinformatics was used to analyze the effect of the mutation on the structure and function of the protein.In addition,corresponding treatment and follow-up were given according to the symptoms of the patients.Results:1.The clinical characteristics of this LQTS family are typical of paroxysmal syncope with familial genetic predisposition,and two of the family members have suffered sudden death.The electrocardiogram of the proband was characterized by prolonged QT interval and incised T wave.2.In a sick of the LQTS KCNH2 genes exon 3 and found a lack of new mutations c.381 408delcaatttcgaggtggtgatggagaaggac(p.A sn128TrpfsTer156),through bioinformatics analysis method,to other species(mice,cows and rats),comparing the homologous protein sequences found in this study orientation KCNH2 genes mutations in a highly conserved in evolution area,the translation of the mutations can lead to frameshift,128th asparagine mutation for tryptophan,In addition,the 156th codon presented early termination codon,leading to early termination of translation,truncation of the product protein,less than 1/9 of the normal product,and loss of most structure and function of the product protein due to this mutation.The mutation was co-isolated from the affected individuals and did not occur in the unaffected individuals of the family or in 50 unrelated individuals.3.The clinical symptoms of the LQTS family found in this study were mainly manifested by the history of paroxysmal syncope of several members of the family,including two sudden deaths.The electrocardiogram of the proband was characterized by prolonged QT interval and incised t-wave.Give the propositus beta blockers(propranolol)joint installation implantable implantable Defibrillator(Implanted-Cardiac Defibrillator,ICD)treatment,the treatment effect,follow-up of patients not yet again the onset of syncope.Conclusions:1.Clinical manifestations of LQTS are typically paroxysmal syncope and sudden death with familial genetic predisposition.The electrocardiogram is characterized by prolonged QT interval,abnormal T wave,which is mainly manifested as wide T wave base,reduced amplitude,and incised,bimodal and bidirectional T wave.Typical clinical symptoms of LQTS families found in this study:Sudden death of two members in the family,significant prolongation of QT interval in ecg,and incisions of T wave.2.Through this study confirmed that a new kind of LQTS mutation KCNH2 genes related c.381 408delcaatttcgaggtggtgatggagaaggac(p.A sn128TrpfsTer156),type of LQTS2 disease-causing gene mutations database and KCNH2 genes mutation database added new content.3.Combined with the clinical manifestations,electrocardiogram characteristics and the discovery of new mutations of KCNH2 gene,the family was diagnosed as LQTS 2 type.Targeted treatment was given according to the patient's LQTS type,and beta blockers were selected in combination with ICD treatment.The effect of the treatment was obvious,and up to now the patients have not suffered syncope and other symptoms.4.The clinical and molecular genetic characteristics of an LQTS family were studied,and the probands were diagnosed and treated,contributing to the diagnosis and treatment of LQTS and improving the prognosis of patients.