Peutz-Jeghers syndrome is an autosomal dominant disorder characterized by gastrointestinal hamartomatous polyps,mucocutaneous pigmentation,a significant tumor susceptibility.PJS polyps occur in the small intestine,colon,which pathology often showed hamartomatous polyps.Tumor susceptibility in patients with PJS is manifested by a marked increase in tumor risk with age,as well as a broad spectrum of tumors.The elevated cancer risk in PJS patients has been observed in several cohort studies,and it is estimated to be 9–18 times higher than the general population.Among gastrointestinal cancers,increased cancer risk was indicated for the colon,the stomach,the small intestine,and the pancreas.Therefore,to reveal the pathogenesis of PJS gastrointestinal tumors,for PJS patients have important significance.STK11 is considered to be the causative gene of PJS.The gene contains 10 exons,of which exon 1-9 encodes a protein of 433 amino acid residues,a tumor suppressor.The gene can respond to cell growth,apoptosis,autophagy and energy metabolism through P53,PI3 K / AKT,m TOR and other signaling pathways.However,mutations in STK11 cause tumor development and progression by affecting many signaling pathways.But the molecular mechanism has not been clarified.Examples of adenocarcinomas and adenomas that appear in keratinized polyps in PJS patients have been described several times.The researchers proposed the existence of hamartoma-adenoma-cancer sequences.In recent years,nearly 1,000 cases of resected PJ polyps in our hospital for histopathological examination,but rare in adenoid polyps mutation.In the report of 4 cases of PJS patients with adenocarcinoma,adenoma-like changes in the excised tissue,suggesting that adenoma may not be an essential stage of PJ polyps carcinogenesis.Somatic mutations are involved in the transformation of these two malignant transformations.Therefore,the somatic mutations involved in this process may be the key to reveal the mechanism of malignant transformation of hamartoma.In this study,we collected hamartomas and malignant polyps in 4 PJS patients.Whole exome sequencing was performed for the tissue DNA.The STK11 gene detected different mutations in four patients,including one insertion mutation,two deletion mutations and one splicing mutation: c.837 dup C,c.423445del CAGCGTGCCGGAGAAGCGTTTCC,c.961962del CC,c.290 + 1G> A.A total of 66,768 Gene mutations were detected by whole exome sequencing,which included 65,536 point mutations and 1232 insert deletions.A total of 187 candidate genes were obtained after bioinformatics analysis.MAPK signaling pathway is obtained by pathway enrichment analysis,which includes 6 somatic mutations?FGFR1,MAP3K5,CACNA1 G,NTF3,PRKCA,NF1?.These somatic mutations were confirmed by Sanger sequencing.Therefore,we speculate that MAPK pathway may be involved in the malignant transformation of PJS hamartoma polyps.This will provide the basis for the future research of PJS tumorigenesis. |