Font Size: a A A

Analysis Of MdTFL1-2 Promoter Sequence Variation And Its Effect On Related Genes Expression During Floral Induction In Malus Domestica Borkh

Posted on:2021-02-10Degree:MasterType:Thesis
Country:ChinaCandidate:L Z ZhangFull Text:PDF
GTID:2393330620472934Subject:Fruit tree breeding and biotechnology
Abstract/Summary:PDF Full Text Request
Md TFL1 could inhibite floral induction and delay the transition from vegetative growth to reproductive growth.Previous studies have shown that the flowering ability of different apple resources was significantly related to the expression levels of Md TFL1,but the underlying reasons and regulatory mechanisms still need to be resolved.In this study,’Nagafu NO.2’with different fruit load were used as the plant materials(The trees with heavy fruit load were HFL,and the trees with low fruit load were OFL),and the GAs content and the expression pattern of Md TFL1 during floral induction were detected after exogenous GA3 treatment.The promoter sequences of Md TFL1-2 in apple resources with different flowering characteristics were cloned,the characteristics of mutations were analyzed.This study is helpful to analyze the expression characteristics of Md TFL1-2 and its relationship with flowering ability in different apple resources.It has important theoretical and practical significance for genetic improvement of flowering characteristics and development of flower regulation techniques.1. Nine-year-old’Nagafu NO.2’with different fruit load were used as materials,the endogenous GAs content and the expression patterns of Md TFL1 in spur buds during floral induction were detected after exogenous GA3 treatment.The length,width,fresh weight of a spur bud and the flowering rate of OFL were significantly higher than those of HFL.The expression levels of Md TFL1-1 and Md TFL1-2 were firstly increased and then decreased.The expression level of Md TFL1-2 in HFL was higher than that in OFL at 70 d after full bloom.After GA3treatment,the length,width and fresh weight of a spur bud were reduced.The endogenous GAs content were firstly decreased and then stabilized.The GA1+3content was always higher than that of the control.The expression levels of Md TFL1-1 and Md TFL1-2 were increased after treatment.In summary,Md TFL1 is an inhibitor of floral bud differentiation,of which Md TFL1-2 may mediate flower bud induction by load regulation.2. Coding regions(six samples)and promoter sequences(eleven samples)of Md TFL1-2 from various apple resources with different flowering characteristics were cloned.There were base differences in Md TFL1-2 coding regions of different apple resources,but they did not change the key amino acids(His88,Asp144).Cloning 2000 bp promoter sequences upstream of Md TFL1-2 coding region from different apple resources,a27 bp sequence(GATGAATTTGTATCTACAAGACAAATA)was found to have a different number of tandem repeats(the different promoters were represented by R1 and R3,according to the number of repetitions).The promoters of Md TFL1-2 of‘Nagafu NO.2’,‘Micui’and‘Huashuo’were R1:R1 type,the promoters of Md TFL1-2 of’Yanfu No.6’,’Qinguan’and’Golden Delicious’were R1:R3 type and the promoter of Md TFL1-2 of’Gala’was R3:R3 type.The coding regions of Md TFL1-2 in different apple resources were relatively conserved,and the promoter sequences were rich in variation,showing the different repeat times of 27 bp sequence.3. In order to further analyze the biological function of the Md TFL1-2 promoter mutation,promoter activity analysis,expression characteristic analysis and yeast one-hybrid library screening system tests were performed.It showed that the promoters’activities of R1,R3 and R5(artificial synthesis)decreased with the increase of the number of the 27 bp sequence repeats.The expression levels of Md TFL1-2 in flower buds of‘Nagafu NO.2’and‘Micui’were higher than those of other resources in the early and middle stages of floral induction.The expression level of Md TFL1-2 in flower buds of’Gala’was low during the whole stages of floral induction.In summary,different types of promoter mutations affect the transcriptional level of Md TFL1-2 to a certain extent.In order to determine whether the mutation of Md TFL1-2 promoter would affect its binding to transcription factors and regulate flowering traits,this study selected promoter sequences containing mutation sites for yeast one-hybrid library screening system.Genes related to lateral organ development,ethylene,auxin,and jasmonic acid were screened(Md LOJ,Md APC10 and Md CUL1),and they were found to be unable to bind to the Md TFL1-2 promoter.4. In order to further analyze the regulatory mechanism of Md TFL1-2 on apple flower bud differentiation,yeast two-hybrid and Bi FC experiments were designed in this study.It was found that there was a protein interaction between Md TFL1-2 and Md NAC090.Md NAC090 was localized in the nucleus,and its expression level in flower buds at the late stage of floral induction was higher than that in leaves and fruits,and it was also expressed to a certain extent in flowers.Interaction between Md TFL1-2 and Md NAC090 may regulate apple floral induction.
Keywords/Search Tags:apple, floral induction, MdTFL1-2, promoter mutation, transcriptional regulation
PDF Full Text Request
Related items