Study On The Response Mechanism Of MiR408 To Low Temperature Stress In Banana Tissue Culture Seedlings

Banana is an important cultivated fruit tree in tropical regions and is widely planted in southern China.The development of the banana industry is susceptible to environmental impacts such as drought in summer and low temperatures in winter and spring.Low temperatures often lead to a decline in banana production and bring losses to banana farmers'economies.mi R408 is one of the highly conserved mi RNA families in plants.mi R408 and its target genes play an important role in plant growth and stress.Previous studies have found that mi R408 is specifically expressed in low temperature stress in wild bananas.Therefore,studying the mechanism of mi R408 and its target genes involved in banana response to low temperature stress is of great significance for the study of banana cold resistance.In this study,the tissue culture seedlings of wild bananas of Sanming and cultivar'Tianbao'banana?AAA?were used as materials,and the changes of chlorophyll fluorescence parameters and photosynthetic pigment content in bananas under different low temperature stress were measured;analyzing the expression of mi R408 family and predicting target gene Chemocyanin,Ma PFK3,Laccse;cloning the target genes Chemocyanin and Ma PFK3based on transcriptome data of wild banana and genome database,performing bioinformatics analysis and expression analysis;and identifing the banana laccase gene family and bioinformatics analysis,the promoter sequences and cis-acting elements of different members were analyzed,and the expression of some Ma LAC members was analyzed.The purpose of this study was to explore the mechanism of mi R408 and target genes involved in cold resistance mechanism of bananas,and to provide guidance and scientific basis for improving cold resistance of cultivated bananas.The main findings are as follows:1 Changes of chlorophyll fluorescence parameters and photosynthetic pigments of bananas under low temperature stressThe tissue cultured seedlings of Sanming wild banana and'Tianbao'banana were treated at low temperature of 0?,4?,13?,and 28?as control?CK?,and the chlorophyll fluorescence parameters and photosynthetic pigments were measured under different treatments.The results showed that,low temperature stress increased F₀and NPQ and reduced Fv/F₀,Fv/Fm,Y???,ETR in banana.The chlorophyll fluorescence parameters of'Tianbao'banana changed more than Sanming wild banana.The change of chlorophyll fluorescence parameters of'Tianbao'banana is greater than that of wild banana in Sanming.Low temperature stress also reduced chlorophyll a content,chlorophyll b content and carotenoid content in leaves of banana tissue culture seedlings.The decline of'Tianbao'banana was greater than that of wild banana in Sanming.The results show that low temperature stress can damage the photosynthetic system and photosynthetic pigment of bananas,indicating that photosynthesis plays a role in banana response to low temperature stress.2 Expression analysis of mi R408 family members in banana under low temperature stressWith reference to the banana A genome data and mi RBase database,and the transcriptome database of Sanming wild banana and'Tianbao'banana under low temperature stress,according to reads,download the mature bodies of banana mi R408 family members.Using q RT-PCR method to detect the expression of Sanming wild banana and'Tianbao'banana seedlings under different low temperature treatments.The results showed that under different low temperature stresses,the expression level of mi R408b in Sanming wild banana decreased,and the expression levels of the other 7 members increased.At 13°C,the expression levels of mi R408b-2,mi R408-5p,mi R408d reached the highest;at 4°C,the expression levels of mi R408-3P-3,mi R408-3P-2 reached the highest;at0°C,the expression level of mi R408a and mi R408-3P-1 reached the highest.Under different low temperature stress,the expression of mi R408b-2 decreased in'Tianbao'banana,and the expression of the other7 members increased.At 13°C,the expression levels of mi R408a reached the highest;at 0°C,the expression levels of mi R408b,mi R408d,mi R408-3P-1,mi R408-3P-2,mi R408-3P-3,mi R408d,mi R408-5p reached the highest.The above results indicate that mi R408 family members may play an important role in banana response to low temperature stress.3 Cloning of mi R408 target gene Chemocyanin and expression analysis under low temperature stress in bananaUsing online software to predict the target gene of mi R408,it was found that the predicted Chemocyanin gene was related to plant stress resistance.Using Sanming wild banana and'Tianbao'banana leaves as materials,the RT-PCR and RACE technology were used to clone the Mi Chemocyanin?Mi CHY?in sanming wild bananaa and Ma Chemocyanin?Ma CHY?in'Tianbao'banana.The results showed that the full-length c DNA of Mi CHY is 587 bp,open reading frame?ORF?is381 bp,encoding a 126 amino acid protein,with a plantacyanin domain,belonging to the cupredoxin superfamily.There is a highly matched mi R408b binding site?GCTCAGGGAAGGGGCAGTGCG?at the 4?24bp of the ORF region.RLM-5'RACE analysis showed that mi R408b mainly cleaves the target gene Mi CHY m RNA between the 7th and 8th bases of the target sequence.Sequence alignment showed that 82 bp of the Ma CHY was more than that of the Mi CHY,which was consistent with the intron GT-AG cleavage,suggesting that alternative splicing of intron retention occurred in'Tianbao'.Conserved domain analysis showed that Ma CHY does not have a Plantacyanin domain,but also belongs to the cupredoxin superfamily.The results of q RT-PCR showed that,in the cold-sensitive'Tianbao'banana,the expression of mi R408b increased,under low temperature stress,and the expression of Ma CHY decreased.On the contrary,in the cold-resistant Sanming wild banana,under low temperature stress,the expression of mi R408b decreased,and the expression of Mi CHY increased.The expression levels of Mi CHY?Ma CHY and mi R408b were negatively correlated.The above results indicate that mi R408b and its target gene Mi CHY may play an important role in banana response to low temperature stress.4 Cloning of mi R408 target gene Ma PFK3 and Ma PFK gene family identification in banana,expression analysis under low temperature stressMa PFK3 gene is predicted to be regulated by mi R408-5P in the low temperature transcriptome of sanming wild bananas.Therefore,the Ma PFK gene family members was identified in the whole A genome of Musa acuminata,the protein characteristics,phylogenetic tree,and the FPKM values of Ma PFK gene family were analyzed by the bioinformatics methods.RT-PCR was used to clone Ma PFK3 from'Tianbao'banana by using RT-PCR,analysising bioinformatics,q RT-PCR was further used to detect the expression of Ma PFK3 under low temperature stress.The results showed the Ma PFK gene family contained 12 members.The phylogenetic tree indicated that the Ma PFK gene family could be divided into three group.FPKM values showed that Ma PFK members are up-regulated or down-regulated to varying degrees under 13?,4?,0?under different low temperature stress.Using RT-PCR to clone Ma PFK3,the coding sequence of Ma PFK3 is 1617 bp in length and is predicted to encoded 538 amino acids.The encoded protein of Ma PFK3 belongs to the PFK superfamily.It is an unstable acidic hydrophilic protein without signal peptide and has transmembrane structures.Subcellular localization prediction results showed that Ma PFK3 located in the cytoplasm.Ma PFK3 Promoter cis-acting elements prediction analysis results showed that the promoter contains light response,hormone response,and stress-related elements.The results of q RT-PCR analysis showed that the expression of Ma PFK3 gene was tissue-differentiated,leaves>pseudostems>roots,down-regulated under low temperature stress,and the expression level of Ma PFK3 is 13?<4?<0?.The above results indicate that members of the Ma PFK gene family memeber can respond to banana low temperature stress.4 mi R408 target gene laccase gene family identification in banana and expression analysis under low temperature stressLaccase gene has been reported as a target gene of mi R408 in many plants.Using the online website to predict the target gene of mi R408 in banana,it was found that three members of the laccase gene were predicted.Therefore,members of the banana laccase gene family were identified and further expressed.Bioinformatics method was used to identify the members of banana laccase gene,and to analyze their expression under low temperature stress.22 laccase genes?Ma LAC?were identified from Musa acuminata genome and 11 laccase genes?Mb LAC?were also identified from Musa balbisiana genome.Most of Ma LAC and Mb LAC menmbers contain three typical Cu-oxidase domains.Gene structure analysis showed that most of Ma LAC and Mb LAC were composed of five introns and six exons.Phylogenetic clustering analysis indicated that the Ma LAC were divided into five groups and the Mb LAC were divided into four groups.The promoter cis-acting element showed that the Ma LAC promoter sequence contained a large number of stress response elements,such as light response,hormone response and abiotic stress.The results of q RT-PCR analysis showed that the expression of some members of Ma LAC increased under low temperature stress.The expression of Ma LAC3-2,Ma LAC4,Ma LAC4-5,and Ma LAC17 increased significantly at low temperatures of 13?,4?and 0?.Moreover,18 Ma LAC transcripts were found to be potential targets of mi R397 or mi R408.The above results might provide valuable reference for further studies of the Ma LAC in banana adaptation to low temperature stress.Through this study,we found that mi R408 and target genes will have significant differential expression stress in banana under low temperature.According to the bioinformatics analysis of target genes,it is speculated that mi R408 can participate in photosynthetic pathways,glycolytic pathways in banana under low temperature stress.It is speculated that mi R408 and target genes play an important role in banana response to low temperature stress.