Malusxiaojinensis were mainly distributed in the upstream of Minjiang River and Dadu River Basin,discovered as the first apple tree in China that iron efficient,is extremely important for apple germplasm resources.This study tookmalusxiaojinensis as materials,cloning of transcription factor Mxb ZIP10 upstream promoter,the main results are as follows according to biological information ofthe promoter:1)According to the Mxb ZIP10 sequence,highly homologous sequences was found in NCBI.Clone the Mxb ZIP10 upstream promoter by PCR method.The upstream and downstream primers of PCR are GCTATCCACAAACTCCTAAA and AACATATAGACTCTCTCCGC respectively,and finally successfully cloned Mxb ZIP10 upstream promoter 1489 bp.2)Get DNA from malusxiaojinensis by CTAB method,spectrophotometry and gel electrophoresis were used to detect DNA.The results showed that malusxiaojinensis DNA absorbance value was 0.012 at the wavelength of 260 nm,while absorbance value was 0.006 in the 280 nm,and 260 nm / 280 nm value is 2,the concentration of DNA in malusxiaojinensis is 120 g/m L.Took malusxiaojinensis DNA as template,amplified by PCR program,get a strip of 1500 bp,the target band of DNA recovery.The cloned DNA fragments were cloned into the p GEM-T vector and transformed into the super sensitive state which had been prepared,and screened by blue and white.Plasmids were extracted from the positive clones and named as T-pro Mxb ZIP10.The sequencing results showed that malusxiaojinensis Mxb ZIP10 promoter contains 1489 bp nucleotide sequence.3)The upstream promoter of Mxb ZIP10 was analyzed by software plant CARE.The promoter sequence contains core components,17 TATA-box and 12 CAAT-box.In addition,functional elements such as functional components ABRE in response to ABA,functional elements HSE 1?LTR 1 in response toadversity,and functional elements G-box responsive to light are also included.In summary,Malusxiaojinensis as an important iron nutrition of fruit tree resources,study the absorption mechanism of iron and provide the basis for fruit trees and other crops,and solve the crop growth and provide a theoretical basis for the development of plant.the upstream promoter of Mxb ZIP10 provides an important basis for studying the regulatory mechanism of Mxb ZIP10 expression,have a great significance. |