Font Size: a A A

Mechanisms Of Regulation Of LitR Protein On Virulence Genes In Aeromonas Hydrophila

Posted on:2020-08-10Degree:MasterType:Thesis
Country:ChinaCandidate:Y LiFull Text:PDF
GTID:2370330620470722Subject:Biology
Abstract/Summary:
Aeromonas hydrophila is a typical human-animal-fish pathogen.The release of virulence factors is regulated by quorum sensing(QS)system.There are two QS pathways in Aeromonas hydrophila.One QS pathway uses acyl homoserine lactones(AHLs)as signal molecules and the other QS pathway uses furyl borate diesters(AI-2)as signal molecules.It has been reported that QS regulators AhyRI and LuxS in A.hydrophila regulate LitR.LitR is highly similar to the conserved sequences of reported QS regulators in seven pathogenic bacteria.Therefore,we speculated that LitR is a response factor of two quorum sensing pathways in A.hydrophila and might function as a QS regulator.In order to explore the regulation mechanism of LitR protein in A.hydrophila,the relationship between LitR expression and bacterial concentration,the influence of litR gene deletion on transcription of virulence genes and the in-vitro combination of LitR and virulence genes was studied.First,a recombinant strain Escherichia coli BL21(DE3)-pET28a-litR used for LitR heterologous expression was constructed.LitR protein expression was induced with IPTG.Then,LitR protein was purified by affinity chromatography and gel filtration chromatography.Afterwards,polyclonal antibody was prepared with purified LitR protein.The relationship between the expression of the protein and the cell concentration was analyzed by western blot with Gap-2 as an internal reference protein.The results showed that the expression of LitR protein in A.hydrophila was positively correlated with cell growth.Secondly,the litR gene deletion suicide plasmid pWM91-litR was constructed and transferred into the donor strain E.coli SM10(λpir)competent cells.The suicide plasmid was transformed into the recipient strain A.hydrophila by conjugation.The fragment of litR was integrated into the genome by homologous recombination technology.The litR gene deletion mutant was successfully constructed through resistance screening and was verified sequencing.The regulation of LitR protein on eight virulence genes,e.g.,hemolysin,cytotoxic enterotoxin,flagellin and lipopolysaccharide synthetic protein,etc.,was studied by Real Time quantitative PCR.The results showed that the deletion of litR gene resulted in the down-regulation of the transcriptional levels of two virulence genes(hemolysin and serine protease)and the up-regulation of six virulence genes(T6SS effector protein,extracellular protease,cytotoxic enterotoxin,flagellin proteins and lipopolysaccharide synthetic protein).Finally,the softberry software was used to predict the promoter regions of virulence genes.The promoter regions were amplified by PCR and mixed with purified LitR proteins for in vitro binding.Electrophoretic mobility shift assay(EMSA)was used to analyze whether LitR protein could directly bind to the promoter regions of virulence genes.DNase I footprinting test was used afterwards to identify the binding sites of LitR protein and virulence genes.The results showed that LitR could directly bind to the promoter region of hemolysin gene.There are totally four binding sites for LitR and binding sites I and II had the strongest binding capabilities.The binding sequences are TAATATATATTTTGCTAAAT TAGAA and TAAGTGATGAATATATATATATATATATG.LitR could bind directly to the promoter region of serine protease and two binding sites were identified as TAATAGTTGATCTACAAAGATAAATAT and AGCCTTATCTCAGA.LitR could directly bind to the promoter region of T6 SS effector protein and the binding site is GGCAAGTTACG.Also,LitR could directly bind to the promoter region of cytotoxic enterotoxin.However,weak binding capability was tested for LitR and the promoter region of extracellular protease with EMSA and no binding capability was tested with DNase I footprinting.
Keywords/Search Tags:Aeromonas hydrophila, quorum sensing, LitR, virulence genes, regulatory mechanism
Related items