Font Size: a A A

Analysis Of Influence Of FlhF Domain And Transcriptional Regulation Mechanism Of FlhF In Campylobacter Jejuni Flagella Synthesis

Posted on:2021-01-22Degree:MasterType:Thesis
Country:ChinaCandidate:X F LiFull Text:PDF
GTID:2370330605956532Subject:Genetics
Abstract/Summary:
Campylobacter jejuni(C.jejuni)belongs to the genus Campylobacter spp.,and is a Gram-negative microaerobic bacterium.It is an important zoonotic pathogen that has been widely investigated in the past decade.Flagella and its mediated motility are considered to be one of the main virulence factors of the pathogen.Until now,the flagellum structure of C.jejuni has been widely studied,but little is known about its synthesis and regulatory mechanisms.Among them,FlhF is a key protein that affects flagella synthesis and motility of C jejuni,and its inactivation leads to complete loss of flagella and motility.Considering the absolute effect of FlhF on flagella synthesis,it is speculated that in addition to indirect regulation of flagella synthesis,FlhF may also act as a transcription factor to directly regulate flagellar gene expression.However,the flhF transcription function and mechanism have not been reported.In this study,flhF gene and its three domain deletion and recovery strains were successfully constructed,and the biological phenotype of FlhF was further analyzed by motility assay and transmission electron microscope.The transcriptome sequencing technology was used to explore the effect of FlhF in flagellar synthesis pathway.EMSA,ChIP-qPCR,and p-galactosidase expression assays were used to screen and verify the target of transcriptional regulation of FlhF,and further analyze the transcriptional regulation mechanism of FlhF in the flagellar synthesis of C.jejuni.1 The influence of FlhF domain on the flagella synthesis in C.jejuniFlhF protein has three domains including B,N and G domain.In order to investigate the influence of FlhF domain on the flagella synthesis,flhF-mutant and complemented strain,as well as B,N,G domain complemented strains were constructed in this study.Using the genomic DNA of C.jejuni 81-176 as a template,the 1000 bp upstream and downstream genes of flhF were amplified by PCR.The kanr resistance gene was amplified by PCR using plasmid pRY107 as a template.The target gene was ligated into pMD-19T(Simple)vector by enzymatic digestion,and suicide vector pMD 19T-flhF-kanr was successfully constructed.Using homologous recombination,the suicide plasmid is electrotransformed into C.jejuni competent cells,the spliced fragment of the suicide plasmid could undergo homologous exchange with the corresponding gene fragment on the genome,and finally a flhF-mutant strain is successfullyobtained.The flhF and B,N,G single-domain complemented strains were further constructed.The flhF gene and its B,N,G domain fragments were amplified by PCR,and the target genes were ligated into the shuttle vector pUOA18-PmetK,which was previously saved by the research group,to obtain pUOA18-PmetK-flhF and pUOA18-PmetK-B/N/G domain recombinant plasmids.The plasmids were introduced into the flhF mutant strain by triparental mating method to obtain the C.jejuni flhF and B,N,G domain complemented strains.Using motility assays and transmission electron microscope observation experiments,it was found that the motility and flagella were completely lost after flhF deletion.However,the B,N,G domain complemented strains could not restore the flagella and motility,respectively.In order to further explore the effects of each domain on the biological phenotype of flhF,the double domains were restored at the same time.Using the genomic DNA of C.jejuni 81-176 as a template,the B,N,G domain fragments were amplified by PCR,and then the BN,NG,and BG fragments were amplified by SOE-PCR.The target fragment was ligated to the pUOA18-PmetK vector,and the BN,NG,and BG domain complemented strains were formed by the triparental mating method.Data showed that the dual domains still fail to restore flagella and motility phenotype,which suggested that any of the domains of the FlhF protein is essential for its function in flagellar synthesis.2 Analysis of transcriptional regulatory pathways of FlhF in Campylobacter jejuni flagella synthesisConsidering the importance of FlhF in flagella synthesis,it is speculated that in addition to the indirect regulation previously reported,FlhF may also directly regulate the transcription and expression of flagella genes.In this study,RNA-Seq was used to further analyze the specific impact of FlhF on the flagella gene transcription level.flhF deletion strain and wild type 81-176 were used to investigate the relative expression of C.jejuni flagella genes at different growth stages by qRT-PCR.Then RNA-Seq assay was performed at time point when genes expression was relatively strong.The cluster and enrichment analysis were performed on the differential genes obtained to determine the metabolic pathways to which the FlhF mutation was mainly mapped.Genes of the flagellum system of C.jejuni were collected to analyze the synthesis of FlhF in flagella influencing effects within the pathway.The results showed that the growth status of C.jejuni was good when cultured for 8 h in vitro,and the relative expression levels of most flagellar genes were high.Comparing the expression profile data of C.jejuni wild type and flhF mutant strains,the difference was greater than 2 and the p value was less than 0.01 as the threshold.A total of 99 differentially expressed genes were obtained,of which 26%were flagella genes(26).In-depth analysis in the flagellar pathway found that FlhF acts as a global regulator in the flagellar system,affecting the overall of flagellar genes.The flagellum genes were classified according to their transcriptional cascade levels and functional relevance.Significant analysis showed that the transcription of flagellin-hook related genes and class II flagellar genes was significantly down-regulated compared to other genes.In order to further investigate the effect of FlhF on the transcriptional expression of flagellar genes,in this study,six significantly changed flagella genes were randomly selected from the RNA-Seq results,including fliK,flaB,flgE,flaA,flgL,and flgI,which promoters were labeled with FAM-S fluorescence.EMSA assay were performed to show that FlhF can bind to the flgl promoter to regulate its expression.ChIP-qPCR was used to verify the results.In order to further explore the specific binding site of FlhF on PflgI,the flgl promoter was divided into six fragments,amplified with FAM-S markers,and ligated to the pMW10 vector to construct the LacZ recombinant reporter plasmid.EMSAs and β-galactosidase assays revealed that the specific binding sequence of FlhF on PflgI was "AAGAAATTTGGATCAACTAGCTTAAG".In order to further investigate whether FlhF directly regulates key regulatory factors(RpoD,RpoN,FliA,FIgSR TCS)in flagella synthesis through direct regulation acting as an overall regulatory role,EMSAs and P-galactosidase assay were performed to find that FlhF can bind to the promoters of rpoD,fliA,flgS.This suggested that FlhF may directly or indirectly regulate the synthesis of class Ⅰ,Ⅱ,and Ⅲ flagellum genes by binding to PrpoD,PflgS,and PfliA,respectively,acting as an global regulatory role.In our study,we speculated that FlhF may directly regulate the synthesis of class Ⅰ and Ⅲ flagellar genes by binding to the rpoD and fliA promoters,activating σ70 and a28 factor respectively.For the class II flagellar genes,FlhF may bind PflgS to stimulate flgS phosphorylation of flgR,cooperating with σ54 factor,indirectly to initiate class Ⅱ gene transcription synthesis.In addition,FlhF may also directly regulate the specific class Ⅱ gene flgl by binding to its promoter.
Keywords/Search Tags:Campylobacter jejuni, flagellar synthesis, FlhF, RNA-Seq, transcriptional regulation
Related items