Effects Of ADAMDEC1 On The Biological Behaviour Of Human Glioma U87 Cells

Objective: To investigate the effect of ADAMDEC1 o n proliferation,adhesion,invasion,migration and apoptosis of huma n glioma U87 cells and its possible mechanism.Methods:1.From the three potentially effective lentiviruses(carrying TACCACGAAA CCTGAGAACAT,CTGATAAGAAGCTTTGTGTTT and TCCCAGG AATCTTGTGAATTT three gene fragments)provided by Shanghai J ikai gene company,we screened the lentivirus that could down reg ulate the expression of ADAMDEC1 in U87 cells:(1)Three kinds of lentiviruses were used to infect U87 cells,and the The optimal multiplicity of infection(MOI)was screened,the transfection efficie ncy was determined by observing the expression of GFP fluorescen ce.(2)Real-time PCR was used to detect the expression of ADAM DEC1 m RNA in U87 cells after three lentivirus infection,the differe nce of ADAMDEC1 mRNA expression in U87 cells after three kind s of lentivirus infection was analyzed and compared,a lentivirus th at could reduce U87 expression of ADAMDEC1 cells was screened out.2.In the experimental group(ADAMDEC1-RNAi),glioma U87 cells were infected with the lentivirus,which was able to downre gulate the ADAMDEC1 expression of U87 cells,and then down regulated the expression of ADAMDEC1 under the optimal multiplicit y of infection.The control group(CONTROL-RNAi)was infected with a negative control lentivirus(carrying TTCTCCGAACGTGTCA CGT gene fragment)under the optimal multiplicity of infection.We stern blot was used to detect the qualitative and quantitative express ion of ADAMDEC1 protein in stably transfected U87 cells,and the expression difference of ADAMDEC1 protein in U87 cells after tr ansfection was analyzed.3.CCK-8 method was used to detect the di fference of cell proliferation and adhesion in two groups,and the d ifferences were analyzed and compared.4.Transwell method was us ed to detect the difference of cell invasion and migration in two gr oups,and the differences were analyzed and compared.5.Flow cyto metry was used to detect the difference between the two groups of apoptosis,and the differences were analyzed and compared.The e xperimental data were analyzed by SPSS 19 statistical software.Th e data were expressed as x ±s.The difference between the two gro ups was analyzed by t test.P < 0.05 was statistically significant.R esults:1.By observing the expression of GFP fluorescence,we can know that the lentivirus carrying specific gene fragments from Sha nghai Jikai gene company can infect human glioma U87 cells,and the optimal multiplicity of infection is 20.2.Real-time PCR showed that carrying TCCCAGGAATCTTGTGAATTT gene fragment lentiviral infection of human glioma U87 cells,compared with the contro l group,the expression level after stable transfection of U87 cells o f ADAMDEC1-RNAi mRNA were significantly decreased(P < 0.01),namely TCCCAGGAATCTTGTGAATTT gene fragments for the effective fragment of inhibiting ADAMDEC1 gene expression.3.Th e results of CCK-8 detection showed that compared with the contro l group,the proliferation(P < 0.05)and adhesion(P < 0.01)ability of U87 cells after downregulation of ADAMDEC1 expression were significantly inhibited by lentivirus carrying effective gene fragments after infection with human glioma U87 cells.4.The results of Tran swell detection showed that compared with the control group,the i nvasion and migration ability of U87 cells after down-regulation of ADAMDEC1 expression decreased significantly after infection of hu man glioma U87 cells with effective gene fragments(P < 0.01).5.The results of flow cytometry showed that compared with the contr ol group,down regulation of ADAMDEC1 expression could promot e the apoptosis of U87 cells after infection of human glioma U87 cells with effective gene fragments(P < 0.01).Conclusion:In vitro cell culture experiments,down-regulation of ADAMDEC1 expression can significantly inhibit the proliferation,adhesion,invasion and mi gration of U87 cells and promote the apoptosis of U87 cells.