Font Size: a A A

The Influence Of ART On The Evolution Of HIV-1 Quasispecies

Posted on:2018-08-20Degree:MasterType:Thesis
Country:ChinaCandidate:K D FengFull Text:PDF
GTID:2334330518459954Subject:Pathogen Biology
Abstract/Summary:
BackgroundThe natural process of human immunodeficiency virus(HIV)infection can be divided into acute infection,asymptomatic and acquired immunodeficiency syndrome(AIDS).Acute HIV infection(AHI)is the period that between HIV acquisition and development of the detectable antibodies against the virus.Early HIV infection(EHI),including AHI,was characterized by viral replication rapidly,immune response and immune destruction,besides,viral diversification.Men who have sex with men(MSM)are high-risk groups of HIV infection,the high viral loads of Acute HIV infection and the behavioral characteristics of such populations increase the risk of HIV infection.Human immunodeficiency virus type Ⅰ(HIV-1)is highly variable.After infection,the virus differentiate into a series of highly correlated but differentiated quasispecies,and the quasispecies showd dynamic changes in the individual.With ART,the virus,host and drug interaction.HIV-1 quasispecies composition and distribution was always in a dynamic process of change.HIV established reservoir within the human host early.HIV reservoir size was related to the HIV remission,and the earlier ART was initiated,the lower the HIV reservoir size was after viral suppression.There was a hypothesis that people who had a smaller reservoir size would have a greater chance that achieving HIV remission.However,the kinetics of proviral DNA and quasispecies during early infection remains was not well documented.The next generation sequencing(Illumina Miseq platform)was successfully used in analysis of HIV quasispecies,identification of postexposure infection,and study the transmission and evolution of HIV quasispecie.An approach was established of using the next generation sequencing platform(Hiseq platform)of gag(Group-antigen),pol(Polymerase),env(Envelope)mixed DNA library.This study aim to optimize the approach and apply it to study the evolution of HIV-1 quasispecies in patients initiating antiretroviral therapy(ART)during acute infection.ObjectiveTo optimize an approach of using the next generation sequencing platform(Hiseq platform)of gag,pol,env mixed DNA library and apply it to study the evolution of HIV-1 quasispecies in patients initiating antiretroviral therapy(ART)during acute infection.Subjects and Methods1.SubjectsEight patients with acute HIV-1 infection on ART were enrolled as research subjects.They were treated with antiviral therapy immediately after the diagnosis of HIV-1 acute infection.Their blood was collected and they were followed up until the 96th week of treatment.All specimens were analyzed at baseline,2nd,4th,8th,12th,24th,48th,72th and 96th weeks,respectively,DNA was extracted from peripheral blood mononuclear cells(PBMC).2.MethodsDNA was extracted from the baseline blood specimen and The HIV-1 gag,pol and env gene fragments were amplified by direct sequencing of nest PCR,products were sequence directly.Then Subtypes were considered based on the sequence of HIV.The approach was optimized of using the next generation sequencing platform(Hiseq platform)of gag,pol,env mixed DNA library.Including the reaction conditions and primers that coverd as many subtypes as possible.DNA was extracted from the followed up blood specimen.The Hiseq target fragments(about 400bp)were amplified.After agarose gel electrophoresis and ultraviolet imagingdetection,the amplified products were purified by one generation and then purified.The DNA library was constructed and then subjected to Hiseq sequencing.After data cleaning,the frequency of quasispecies from each specimen was counted and ranked.Intrapersonal and interpersonal genetic distance and phylogenetic tree were calculated.Results1.After ART,the viral load(VL)of HIV-1 followed a pattern of rapid,relatively stable and rapid decline till to be undetectable at 12th week.The number of CD4 T cells decreased at the 2nd and 4th week then recovered.2.The subtypes of HIV-1 from 8 patients were CRF01_AE and CRF07_BC,respectively.3.The length of gag,pol,env gene about 400bp,high brightness and no band generation were the purpose of fragments.The peimer of env gene were V3-D1(TGATGTATTACAATAGAAAAATTCTCCTC)and V3-D2(TGTATTGCAATAGA AAAATTCCCCTC).4.All specimens were successfully amplified at baseline,the first 2 to 12 weeks.with time,amplification success rate decreased.5.Hiseq sequencing was successfully conducted and one hundred thousand level cleaned sequences were obtained.6.At baseline,the frequency of top 1 quasispecies sequence was counted more than 50%of total.With time,the distribution of quasispecies changed:the frequency of top 1 quasispecies sequence of gag、pol gene decreased first,and most of them rebounded from the 12th week then decreased at 48th and 72th week.env gene region before the 12th week changes in the smaller,12 weeks after the change is larger,and the law is different.7.The average intrapersonal genetic distance rate between quasispecies was stable and only fluctuated within a narrow range.8.The average interpersonal genetic distance between the follow-up time and the baseline increased in the first 2 weeks and then remained stable.9.Phylogenetic tree indicated that the quasispecies sequences were scattered at different times and the distance is close.Conclusions1.The approach of using the next generation sequencing of HIV-1 gag,pol,env gene regions has a high practical value in studying the evolution of HIV-1 quasispecies.2.Early ART can cut down the setpoint of HIV-1 VL and prolong the time of quasispecies dispersion.3.When HIV-1 viral load can not be detected,effective nucleic acid information can be obtained by extracting pre-viral DNA for study the evolution of HIV-1 quasispecies.
Keywords/Search Tags:Human immunodeficiency virus, Antiretroviral therapy, Quasispecies, Evolution, Next generation sequencing
Related items