| Decorin, presenting in the extracellular matrix, is a member of the chondroitin sulfate proteoglycan gene family. Decorin also plays an important role in the muscle cell differentiation, migration and adjusting of the connective tissue forming process. Muscle growth and development are closely related to the protein metabolism. A variety of signal transduction pathways involved in the process of muscle protein metabolism. Studies in mammals had shown that Decorin is an extracellular ligand of TGF-beta, it affects cell differentiation and metastasis through this signaling pathway. DCN promotes cell proliferation and differentiation by inhibiting MSTN, egulates muscle growth and development by inhibiting the activity of IGFI R and activating the activity of AKT. Whether DCN through TGF-β/Smad and IGF1/PI3KIAKT/MTOR pathway to realize the regulation of muscle growth and development in duck, it is not yet clear. In this study, we constructed plasmid vector (shRNA-DCN) to silence the function of DCN, and then transfected it to myoblasts and the leg muscle of duckling. In addition, Recombinant human insulin-like growth factors 1 (RH IGF1), which is an chemical activator that stimulates the expression of PI3K gene, was added in cultured duck myoblast. And then, we inspected the proliferation activity of myoblasts by CCK-8, and the status of muscle growth were observed in tissue paraffin section. The expression level of genes in TGF-β/Smad and IGF1/PI3K/AKTIMTOR pathway were tested by qRT-PCR and ELISA, in order to understand the regulation and channel of silencing DCN genes on duck muscle growth and development at cellular and individual level. Main results are as follows:(1) Three shRNAs (shRNA1, shRNA2, and shRNA3) against the DCN gene of duck and a negative control (shControl) were constructed, and one highly efficient interference shRNA3 and 24h,the best transfection time points, were found by transient transfection in duck myoblasts. qRT-PCR and ELISA test results showed that transfecting with shRNA3 can make DCN be suppressed in myoblast and leg muscle of duck. The best sequence of shRNA for silencing Duck DCN gene is CGCAGACACCAACATTACTAG, from 5’to 3’.(2) Respectively transfected duck myoblast with shRNA-DCN and shControl, and relative expression of genes and protein were detected in myoblast by qRT-PCR and ELISA after cultured 24h. Results showed that, the activity of myoblast was significantly reduced, and the expression of 1GF1 R、 PI3K、AKT、MTOR、P70S6K、MYOD、 TGF-βR1 and Smad4 genes and Decorin、PI3K、MTOR、TGF-β3R1 and Smad2 protein were significantly reduced in myoblasts transfected with shRNA-DCN (P<0.05) compared to that transfected with shControl. Indicating that silencing DCN by shRNA-DCN can inhibit the proliferation of duck myoblasts by IGF1/PI3K/AKT/MTOR/p70S6K signaling pathway and TGF-β/Smad signaling pathway.(3) The myoblasts which transfected with shRNA-DCN were cultured for 24 h in the presence RH IGF1 (20ng/mL), and detected relative expression of genes and protein by qRT-PCR and ELISA. Results showed that, compared with the myoblasts transfected with shRNA-DCN without RH IGFI, the proliferation capabilities was significantly enhanced, and the expression of IGF1R、AKT、MTOR、P70S6K and Smad4 genes and Decorin、PI3K、MTOR、TGF-βR1 and Smad2 protein were significantly increased in myoblasts transfected with shRNA-DCN in the presence of RH IFG-□(p< 0.05). Indicating that IGF1 can relieve the proliferation of myoblasts and IGF1/PI3K/AKT/MTOR/p70S6K signaling pathway and TGF-β/Smad signaling pathway decreased by shRNA-DCN.(4) The expression of IGF1R、MTOR、S6K, TGFβR1 and Smad4 genes in the IGF1/PI3K/AKT/MTOR/p70S6K signaling pathway and TGF-β/Smad signaling pathway is reduced in leg muscle of duckling after transfected by shRNA-DCN. But it does not result in obvious changes in muscle fiber diameter and density. This may be related to the regulatory mechanism of self-repair in the process of individual growth and development. |
