Rice is a model plant for genomic research.The breeding of functional special varieties of rice has become an important target of rice breeding.Using CRISPR/Cas9 technology to edit rice gluten genes can shorten time of breeding and improve efficiency of breeding.In this study,we use CRISPR/Cas9 technology to edit rice gluten genes and we can conclude as the following:1.Using CRISPR/Cas9 technology can edit three of the rice gluten genes(LOC_Os01g55690,LOC_Os03g31360,LOC_Os02g16830)successfully.2.In this study,we got the following results: LOC_Os01g55690 gets 2 types of homozygous mutants by CRISPR/Cas9 technology: One is a base(T)insertion;The other one is deletion of six bases(GCTTCG)and replacement of one base(A to C).LOC_Os03g31360 gets 5 types of homozygous mutants: 1,32 bases(TTGCTACACACAGGTAGGGGGGAGAAG)are missed and 8 bases(ATGCATT)are inserted;2,27 bases(GCGCGGAAGATGGAATTCTTTCCTGCC)are missed and 9 bases(CCGCGCACT)are inserted;3,missing 21 bases(AGGAAGTGCGCGGAAGATGGA);4,4 bases(AGAT)missing;5,In this type,45 bases(GAAGATGGAATTCTTTCCTGCCATGTGGCTAACCATGGAGTCAGG)are missed and 59 bases(TCTTCATATGTGGCTAACCATGGAGTCAGGGTTGGTTTTCAATGTCAACAT GATCACAA)are insered.LOC_Os02g16830 gets 1 types of homozygous mutants: insertion of a base T.3.The expression level of 8 types of mutants was analyzed.The results showed that most of the 8 types of mutants were different from the wild japonica variety-Jiahua 1.4.The Gluten of 8 types of mutants were extracted and analysed by SDS-PAGE.We can conclued that the protein expression levels of the 8 types of mutants are not as significant as the changes in transcriptional expression level.5.We investigated the agronomic characters of 8 mutants and found that it is significant different in the number of the panicle,total grain number of per panicle,seed setting rate,yield of per plant with wild type.In this study,the rice protein genes were successfully edited by CRISPR/Cas9 technology,which can provide theoretical guidance for improving rice quality by CRISPR/Cas9 technology. |