The Function Of TetR-like Protein That In Slow Raw Soybean Bradyrhizobium Japonicum In The Early Stages Of Symbiosis

Bradyrhizobium japonicum,a mutualistic symbiont of soybean(Glycine max L.),widely live in the soil of soybean cultivation region over the world.The study on its role in the symbiotic nitrogen fixation is very important.Previously,a large genomic locus of B.japonicum USDA 110 has been captured in a genome-wide transcriptional screening experiment.: This genomic loci were strongly and early induced by genistein,a soybean-released isoflavonoid.Furthemore,it covers three multidrug resistance efflux pump genes(bll7019-bll7021),Upstream of these three genes and in the opposite orientation,gene blr7023 code for a putative TetR-type regulator.Such genetic organization suggests that they likely form an operon.In the present study,the bio-function of blr7023 gene was initially addressed on the genetic and physiological leves as following: firstly,heterologous expression of blr7023 as GST fusion protein and electrophoretic mobility shift assay(EMSA);Secondly,the susceptibility of blr7023 mutant against antibiotics(other harmful substances);finally,the soybean root adsorption experiment.The results showed:1.blr7023 gene can be stabilized expression as soluble GST-fusion protein in E.coli BL21(DE3),the maxmal amount of GST-fusion protein,the was obtained under the following optimized induction conditions : To 1:100 inoculation amount in the bottle,to cultures the bacteria density population OD600 nm = 0.30-0.6,37 ?,the final concentration of inducer IPTG as 0.3 mM,160 r/min and induced 3 h.2.Bioinformatics analysis showed that blr7023 gene is highly conserved among the species the Bradyrhizobium japonicum genus.The DNA – binding site for blr7023 protein was found to be located within the intergenic region of bll7022-blr7023 with a length of 27 bases.3.The intertion mutation of blr7023 specifically enhanced its susceptibility to tetracycline in comparion with wild type B.j110.However its susceptibility to other toxic compounds was not remarkably altered.It suggested that protein of blr7023 regulated the expression of bll7019-bll7022 as a repressor.4.Bacteria adsorption experiments showed that the lack of blr7023 gene significantly reduced the symbiosis and adsorption of rhizobia in the early stage,the ability of fixation tocorresponding hosts roots also affected the nodules,nitrogen fixation,etc.thereforeBlr7023 gene plays an important function in the early symbiotic symbiotic beneficial genes.Taken together,this study identified a regulatory site of the blr7023 product is as palindrome sequence(AAATAAACTATACCGTATATTTTCTTT)that is located between bll7022 and blr7023.In addition,the mutation of blr7023 specificity enhanced its immune to tetracycline and led to the defected abosorption ability to soybean root.Finally,the deletions ofblr7023 gene alsodelay the nodulation.That the gene may participate in rhizobia in early stages of symbiosis,rhizosphere soil survival and competitive nodulation ability.The gene blr7023 may involved in the nodulation competitiveness of B.japonicum in the early interaction with soybean.