Font Size: a A A

MicroRNA-124 Regulates The Activation Of Microglia By Targeting P38αMAPK And Protects Dopaminergic Neurons

Posted on:2017-03-17Degree:MasterType:Thesis
Country:ChinaCandidate:Z Y ZhuFull Text:PDF
GTID:2284330488483295Subject:Surgery
Abstract/Summary:
Parkinson’s disease (PD), is one of the most common neurodegenerative diseases of the elderly, the incidence of PD is second only to Alzheimer’s disease. The main clinical manifestations include static tremor, bradykinesia, myotonia and abnormal gait posture. The etiology and pathogenesis of PD is not clear to date. therapeutic methods for PD are limited, pharmacotherapy and surgical strategies can only relieve the clinical symptoms, but can not prevent the disease from progressively deteriorating, not to mention radical cure. Therefore, to clarify the pathogenesis of PD therefore benefit the exploring of new therapeutic targets and treatment strategies is of great significance. Finding new approaches to PD treatment is one of the areas of research focus in neuroscience.The pathological characteristic of PD is the degeneration of the midbrain dopaminergic (DA) neurons. In recent years, it has been demonstrated that chronic inflammation plays a important role in the process of neuro-degeneration. Microglia, as the most important innate immune cells in the central nervous system, is an important participant of nerve inflammation. Microglia can play a role of neuroprotection or neurotoxicity depending on the microenvironment. Under physiological conditions, microglia stay in the resting state and can remove apoptotic cells and metabolic waste by phagocytosis, therefore, maintain the steady state of neurons and glial cells. At the same time, they also play a significant role in immune surveillance. Activated microglia present ameboid in morphology, they release a large amount of proinflammatory cytokines and the neurotoxic material such as reactive oxygen species, which lead to DA neurons apoptosis. Damaged DA neurons in turn stimulate the microglia activation, which form a vicious circle of pathological process. Intervention the activation of microglia, therefore, is expected to be an effective strategy to prevent the onset and relieve the progression of PD. Therefore our research purpose is to explore the approach to regulate the microglial cells activation, cut off the vicious cycle and alleviate neurons injury.MiR-124 is a high specific miRNAs in central nervous system and is thought to play a key role in the growth and development of brain. Research has demonstrated the relations between miR-124 and the activation state of microglia. MiR-124 can maintain the resting state of microglia and regulating its activation state through C/EBP-alpha-PU.1 signal pathway channel. Whether miR-124 plays a role in the process of proinflammatory cytokines secretion in microglia is still unknown. Therefore, we focus on the regulation effect of miR-124 on proinflammatory factor secretion in microglia and its potential mechanism.P38a belongs to the family of p38MAPK, which involves in the regulation of diverse physiological processes, such as inflammation, cell growth, differentiation, cell cycle and necrosis. To date, four subtypes of p38MAPK, p38a, p38β, p38y and p38δ, have been identified. They have distinct coding genes, tissue specificity and functions. P38alpha is essential for proinflammatory cytokines secretion as well as neuron degeneration mediated by LPS-activated microglial. Bioinformatics and in vitro experiments have predicted p38a a target genes of miR-124.In cerebellar granule cells p38α has proved as a target genes of miR-124 and miR-124 significantly inhibit the expression of p38a. However, whether miR-124 has the same regulation effect on p38a in microglia has not been proved.We first detected the expression of miR-124 in LPS stimulated BV-2 cells. Then miR-124 mimics and inhibitor were transfected into BV-2 cells, respectively, and the expression levels of TNF-a and IL-1β were then detected. After confirming p38a is also negatively regulated by miR-124, we invited VX702, a second generation p38a specific inhibitors, to further investigate whether miR-124 regulate microglia activation state through p38a pathways. Finally, we set up a special co-culture system based on conditional medium transfer, the conditioned medium of microglia cells, pre-stimulated with various agents, is then transferred to the neuronal cell culture.supernatant of BV-2 cells was collected and mixed with fresh medium conditional medium used for training after SH SY5Y, to explore the miR-124 control BV-2 cells activity of neuron protection. Our research furthers the understanding of inflammatory mechanisms of PD, and provides a potential target for the therapeutic strategy development. Methods and materials 2.1 Cell Culture and treatmentsBV-2 microglia cells and SH-SY5Y cells were obtained from Central laboratory of Nanfang Hospital (Guangzhou, China). BV-2 cells were cultured in DMEM (Gibco, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (Gibco) and 0.1% penicillin-streptomycin (Sigma-Aldrich, St. Louis, MI, USA). BV-2 cells were treated with LPS (Sigma) at a final concentration of 0.1μg/ml. VX702 (Selleck chemical, Houston, TX, USA), a second-generation p38a specific inhibitor, was used at a final concentration of 50nM. SH-SY5Y cells were maintained in DMEM/F12 (HyClone, UT, USA) plus 10% fetal bovine serum (Gibco). Both cells were cultured at 37℃ in a humidified incubator with 5% CO2. A conditioned medium transfer system was established as previously described.2.2 TransfectionThe miR-124 mimics, control miRNA-mimics, miR-124 inhibitor and anti-microRNA control inhibitor were synthesised by Ribobio (Guangzhou, China) and transfected into BV-2 cells by using riboFECTTM CP (RiboBio) according to the manufacturer’s protocol. The miRNA-124 mimics sequence was (5’-CCGUAAGUGGCGCACGGAAU-3’). The miR-124 inhibitor sequence was (5’-GGCAUUCACCGCGUGCCUUA-3’). The culture medium was replaced by fresh DMEM 24hr after seeding. Then cells were transfected with mir-124 mimics (50nM) or miR-124 inhibitor (100nM) according to the recommended concentration. Three independent experiments were performed in this study.2.3 RT-qPCRTotal RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RT-qPCR for the detection of miR-124 was performed using miR-124-specific PCR primers (RiboBio) with PrimeScript RT Master mix (5X) and SYBR Premix Ex TaqTM Ⅱ (Takara, Dalian, China) according to the manufacturer’s instructions, normalized to U6 snRNA. For the mRNA quantification of protein-encoding genes, the RNA was reverse-transcribed with a random primer and the mRNA levels were determined by RT-qPCR. A primer pair for the detection of mouse GAPDH was used as the internal control. Results are presented as fold changes in gene expression calculated using the AACt method. All the sequences of the primers used were listed as follows: MiR-124 RT primer:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATT MiR-124 forward:GCGGCGGTAAGGCACGCGGTG MiR-124 reverse:ATCCAGTGCAGGGTCCGAGG P38α forward:CCAAGCCATGAGGCAAGAAA P38a reverse:CTTGGGCTGCTGTGATCCTC TNF-α forward:TATGGCTCAGGGTCCAACTC TNF-α reverse:GGAAAGCCCATTTGAGTCCT IL-1β forward:CTCACAAGCAGAGCACAAGC IL-1β reverse:CAGTCCAGCCCATACTTTAGG GAPDH forward:CAAAATGGTGAAGGTCGGTGTG GAPDH reverse:TGATGTTAGTGGGGTCTCGCTC2.4 Cytokine AssaysBV-2 cells(1 × 105)were seeded into 24-well plates and incubated overnight. Cells were transfected with miR-124 mimics/negative control or miR-124 inhibitor/negative control for 24h before stimulated by LPS(100ng/ml)for 12h.The concentrations of pro-inflammatory cytokines TNF-α and IL-1β in culture supernatants were determined by ELISA kits(Excell Bio,Shanghai,China)according to the manufacturer’s protocol.2.5 Western blottingTotal protein was extracted from BV-2 cells using RIPA lysis buffer(Beyotime, Jiangsu,China)with protease and phosphatase inhibitors(biotools,Olathe,KS,USA) following the manufacturer’s protocol.Western blotting was performed as previously described.Antibodies used were as following:rabbit anti-p38α,rabbit anti-p-p38, rabbit anti-ERK,rabbit anti-p-ERK,rabbit anti-GAPDH(all from Abcam,Cambridge, MA,USA),goat anti-rabbit IgG-HRP(life technologies).2.6Cell viability assayCell viability was analyzed using a WST-8 Cell Counting Kit-8(Dojindo,Tokyo, Japan).SH-SY5Y cells(5×103)were seeded in 96.well plates and incubated for 24hr. After incubated with the conditioned medium for another 24hr. CCK-8 solution (10μl) was added to each well and the cultures were incubated at 37℃ for 90 min. Absorbance at 450nm was measured using an immunoreader.2.7 Flow cytometry analysisSH-SY5Y cells apoptosis were quantified using an annexin V-fluorescein isothiocyanate/propidium iodide (PI) apoptosis detection kit (Dojindo, Tokyo, Japan). SH-SY5Y cells (5 × 10s) were seeded into 6-well plates for 24hr then incubated with conditioned medium for an additional 24hr. The cells were then harvested and stained with annexin V-fluorescein isothiocyanate and PI. The cells were incubated at room temperature for 15 min in the dark. The number of apoptotic cells was assayed with flow cytometry (Becton Dickinson, CA, CT, USA).2.8 Statistical analysisAll data were presented as mean±SD from three independent experiments. Statistical analysis was carried out using one-way ANOVA (Dunnett’s t test) and two-tailed Student’s t-test. P<0.05 was considered to indicate a statistically significant difference.Results3.1. MiR-124 was down-regulated in LPS-treated BV-2 cells.After seeded in the plates for 24hr, BV-2 microglia cells was incubated with increasing concentration of LPS (0.1,0.5 and 1μg/ml) for another 24hr, the expression level of miR-124 was detected by RT-qPCR. Results showed that compared with control group, there is a significant decrease of miR-124 expression in LPS-treated BV-2 cells (p<0.05) and the effect showed a dose-dependent manner. To establish a time-course for this event, changes in miR-124 level were monitored by RT-qPCR at different time-points (1,6,12 and 24hr), following stimulation of BV-2 cells with LPS (0.1μg/ml). The level of miR-124 continued to decrease after LPS treatment, a significant decrease was observed after an incubation period of 12hr, and this effect becomes much more pronounced at 24hr.3.2 Over-expression of miR-124 suppressed the expression of TNF-a and IL-1β in LPS-activated BV-2 cells.Firstly, BV-2 cells were transfected with miR-124 mimics or inhibitor for 24hr, then the expression level of miR-124 was detected by using RT-qPCR, results showed transfection with miR-124 mimics significantly increase whereas miR-124 inhibitor significantly decrease the level of miR-124(p<0.05).then, BV-2 cells were transfected with miR-124 mimics or inhibitor for 24hr before exposure to LPS (0.1μg/ml) for another 12hr, TNF-a and IL-1β mRNA and proterin levels were determined by RT-qPCR and Elisa assay. A very strong decrease in TNF-a and IL-1β expression levels was observed following over-expression of miR-124 (p<0.05) whereas a significantly increased following miR-124 inhibition (p<0.05).3.3 MiR-124 regulates the secretion of TNF-a and IL-1β through p38αWe predicted the potential gene targets of mir-124 by using TargetScan software, there is a conserved binding site in the 3’UTR of p38a mRNA for miR-124. We then transfected miR-124 mimics into BV-2 cells for 24hr before detected the expression level of p38a by using RT-qPCR and Western Blot. Results showed p38a expression was reduced at both the protein and the mRNA levels as compared with the control group. BV-2 cells pre-transfected with miR-124mimics for 24hr were stimulated by LPS for 30min, then the expression of p38a、p-p38a、ERK and p-ERK were detected by Western Blot. Results showed that miR-124 mimics significantly inhibited p38α、 p-p38a (p<0.05) but have no effect on ERK and p-ERK(P>0.05). BV-2 cells pre-treated with VX702 were transfected with miR-124 mimics and inhibitor before stimulated by LPS, expression level of TNF-a and IL-1β were detected by Elisa assay. Results showed when the BV-2 cells were pre-treated with VX702, there was no significant difference in TNF-a and IL-1β levels whether miR-124 mimics or miR-124 inhibitor was transfected. Pre-treat with VX702 significantly reduced the TNF-a and IL-1β levels in miR-124 transfected BV-2 cells compared with non VX702 pre-treated group(P<0.05).3.5 Over-expression of miR-124 prevents neuronal death and apoptosis following microglia activation.For this purpose, BV-2 microglia cells were transfected with miR-124 mimics or control mimics 24hr before exposure to LPS. Following a 12hr incubation with LPS the medium of BV-2 cells was collected and mixed with fresh medium at a ratio of 1: 1 (v/v). SH-SY5Y cells were incubated with this conditioned medium for 24hr before assessment of neurons viability and apoptosis level by CCK-8 assay and flow cytometry analysis. The results showed that SY-SY5Y cultured with conditional medium from miR-124mimics transfected group exhibited a significantly higher survival rate and lower apoptosis rate when compared with the control mimics group(P<0.05).Conclusions1. MiR-124 inhibits the expression of pro-inflammatory cytokines in LPS-activated BV-2 cells.2. MiR-124 attenuates LPS-induced pro-inflammatory cytokines secretion through suppress p38a expression3. Over-expression of miR-124 prevents neuronal death and apoptosis following microglia activation.
Keywords/Search Tags:Neuroinflammation, Microglia, MicroRNA-124, P38αMAPK, Neuroprotection
Related items