Font Size: a A A

The Analgesic Effection Of Lentivirus Mediated SiSCN9A Inhibit The Expression Of Nav1.7 In Nerve Pathological Pain

Posted on:2017-01-26Degree:MasterType:Thesis
Country:ChinaCandidate:P Y LiFull Text:PDF
GTID:2284330485486673Subject:Human Anatomy and Embryology
Abstract/Summary:PDF Full Text Request
Background and purposePrimary injury or dysfunction in the nervous system could cause the allodynia,spontaneous pain, or hyperalgesia, which is called neuropathic pain. Neuropathic pain is characteristic by high prevalence, poor patients’ quality of life, and unsatisfactory treatment. Mechanism of development of neuropathic pain is still not clear.The mechanical damage, metabolic and trophic in nerve changed, the virus infection or radiotherapy neurotoxicity, neuronal ischemic damage, neurotransmitter dysfunction can cause neuropathic pain. At present, the medicine of pain treatment mainly been used by local anesthetics, antidepressants, central depressants and antiepileptic drugs, each of these therapy has weakness,such as the short curative effect, large side effect, and drug dependence. Therefore, an efficient and no side effects way to treatment pain is needed.Recent studies showed that voltage-gated sodium channels Ⅸ alpha subunit(Nav1.7 coding by SCN9A) may closely relate to three abnormal pain disease aserythromelogia, Paroxysmal pain syndrome and congenital analgesia. The mutation of Nav1.7 which is a gain of fuction in erythromelogia and paroxysmal pain syndrome, while Nav1.7 channle fuction in congenital analgesia is absent.Voltage-gated sodium channels Nav1.7 widely expressed in DRG and sympathetic ganglion. DRG neurons express many kinds of ion channels/receptors. These channels and receptors have at least three functions,such as transduction,conduction,modulation of synaptic transmission. After nerve injury, injured and uninjured DRG neurons become more excitable and exhibit ectopic firing.The evidence has been accumulated that the changes in the electrophysiological properties of Nav1.7 causeed abnormal pain sensation. It is reasonable to conclude that this abnormal spontaneous activity might be related to nerve injury-induced changes in the density, distribution, and functional activities of voltagegated sodium channels in the DRG neurons.The aim of our study is to realize the change of Nav1.7 in SNL pain model.We use Lentivirus mediated si RNA-SCN9 A infected DRG neurons to verificate that it can alleviate nerve pathological pain and reversal the expression of Nav1.7.Provided important theoretical and experimental basis for transgenic therapy neuropathic pain. Genetically analgesia is expected to become a new therapy for clinical treatment of pain.Methods1. Constructed the Lentivirus-si SCN9 A, Cultured PC12 cells Transfected Lentivirus-si SCN9 A.2.Cultured DRG cell which come from 21 d SD mouse and used TNF- alpha to stimulate, then observed the Nav1.7expression. Transfected Lentivirus-si SCN9 A to the DRG cell to observe if it can reverse the increased expression after TNF-alpha stimulated. Western-blot detected Nav1.7 expression and detected the infection efficiency by immunofluorescence.3.Tested paw withdrawal threshold of mechanical and thermal of SNL pain model,immunofluorescence double label and Western-blot detected the changes of Nav1.7 in SNL model.4.Lentivirus-si RNA-SCN9 A was micro-injectied to L4/L5 DRG in SNL model. Tested mechanical paw withdrawal threshold and thermal withdrawal latency, immunofluorescence double label and Western-blot detected the changes of Nav1.7 in each group.Immunofluorescence detected the expression of CGRP in spinal dorsal horn, Statistics of fluorescence intensity.Results1.The sequence of si-SCN9 A was ACAGCATGATCTGCTTGTTCC completely match the target gene SCN9 A, when MOI=10 meet our needs,Lentivirus titer determination is 6 x108.2. Western-blot showed Nav1.7 protein was over expression in the cultured DRG neurons stimulated by TNF alpha; Immunofluorescence show EGFP and NF200 double immunofluorescent labeling. LV – Si SCN9 A infection efficiency rate was reached to 80%.Nav1.7 over expression was reversed by LV- si SCN9 A infection in cultured DRG cell which was stimulated by TNF alpha.3. The ipsilateral paw withdraw threshold of mechanical(13.5±0.9 to 2.3±0.6)and thermal(13.7±1.2 to 8.5±0.4)were reduced in SNL group compared with the Sham group; and Western blot showed the Nav1.7 protein was increased after 3d of surgery in L4/L5 DRG of ipsilateral side`x ± s(0.20±0.03 to 0.80±0.07); p =0.002.4. Micro-injection of 2 μ l LV-si SCN9 A and LV-SC in L4/L5 DRG of SNL rat could alleviated neuropathic pain; Immunofluorescence show GFP and Nav1.7 were double immunostaining; Nav1.7 expression was decreased in SNL + LV- si SCN9 A group compared to SNL +LV-SC group(0.5±0.04、0.8±0.05);p =0.03.ConclusionNav1.7 was over expression in cultured DRG cell after TNF alpha stimulated and in L4/L5 DRG of SNL model. LV- si SCN9 A can reverse the increase and alleviate neuropathic pain of SNL model.
Keywords/Search Tags:Nerve pathological pain, DRG dorsal root ganglion, TNF alpha, SCN9A
PDF Full Text Request
Related items