The Molecular Mechanism Of Regulation Of Rapamycin Induced Autophagy By BCL-3

BackgroundAutophagy can be activated when cells under stress to provide the energy required for their own survival; or it can be activated for the normal metabolism of organs under normal circumstances. It is reported that there is a relationship between the occurrence of autophagy and the formation and development of tumors. The BCL-3 belonging to the IκB family, plays an important regulatory role in NF-κB signaling pathways. It is also reported that the abnormal expression of BCL-3 is associated with blood tumor and solid tumor. Although it has been reported that BCL-3 affects autophagy to a certain extent, the mechanism about how could BCL-3 affect autophagy is still unclear now.PurposeTo explore the function and mechanism of BCL3 on Rapamycin induced autophagy and autophagy related proteins in vitro.Methods1.Cell culture:Hela cells were cultured in DMEM (High Glusose) medium containing 10% inactivated fetal bovine serum which were transferred to the incubator containing 5% CO2. On average about once every two days, the liquid was changed and adjust the cell density was adjusted to less than 1 x 106/mL;2.Plasmid:the pGPU6 gemma/GFP/Neo-the BCL-3-homo-558 plasmid expressing the siRNA of BCL3, was purchased from Shanghai GenePharma. The target sequence:GGG AGCTCGACATCTACAACA, template sequence:S:CACCGGGAGCTCGACATCTAC AACATTCAAGAGATGTTGTAGATGTCGAGCTCCCTTTTTTG;A:GATCCAAAAAA GG GAGCTCGACATCTACAACATCTCTTGAATGTTGTAGATGTCGAGCTCCC.3. Cells transfection:shBCL-3 or its control shDNA (NC) was transfected into Hela cells with lipofectamine 2000 plasmid. After 4 to 6 hrs the medium was replaced completely with fresh medium 24h after transfection the cells fluorescence was observed and the cells were lyzed to extract the protein.4. Drug treatment:Hela cells were treated using 1μM Rapamycin, the changes of related molecules were detected by Western Blot.5. Detection of indicators:BCL-3, LC3 and other proteins from the group Hela cells treated with or without Rapamycin were detected by Western Blot. The expression of the key autophagy related proteins and distribution of LC3 in HeLa cells was observed by confocal microscopy.ResultsFirstly, we verified that the antibody targeted BCL-3 could recognize the BCL-3 protein expression in Hela cells. Then shBCL-3 or NC plasmid was transfected into Hela cells respectively, and the result of western blot indicated that the expression of BCL-3 was inhibited by the shBCL-3 markedly on protein levels.1. The results of western blot and laser confocal microscopy indicated that in Hela cells, rapamycin induced autophagy, the expression of LC3 protein was decreased when BCL3 was knocked down campared with the control cells.2. The results of western blot indicated that in Hela cells, rapamycin induced autophagy, there was little change in the expression of ATG5 protein when BCL3 was knocked down campared with the control cells.3. The results of western blot and confocal microscopy indicated that in Hela cells, rapamycin induced autophagy, the expression of Atgl4 and Vps15 protein was decreased when BCL3 was knocked down campared with the control cells.ConclusionBCL-3 plays a regulatory role in autophagy that induced by rapamycin, and its regulation function may be achieved through the non-canonical pathway.