| Objective: Pancreatic carcinoma(PC) is quite a malignant tumor of the digestive diseases, with difficulty in treatment and poor prognosis. The confirmed tumor markers for pancreatic carcinoma,such as carbohydrate antigen 19-9(CA19-9), carbohydrate antigen 242(CA242), carbohydrate antigen50(CA50) are commonly used for diagnosis of pancreatic cancer which are characterized by low sensitivityã€bad specificity and high false positive rate of defects.Therefore,it is necessary to find out new tumor markers associated Pancreatic carcinoma with higher specificity to improve the early diagnosis of it.In our early research,we have identified the candidate tumor markers from serum for the diagnosis of pancreatic cancer,including insulin-like growth factor binding protein-2(IGFBP-2)ã€Tenascin-X〠alpha 2-HS-glycoprotein(AHSR)ã€Pobrmeric immunoglobulin receptor(PIGR)ã€Apolipoprotein A-II(Apo A-II)ã€Serum amyloid A-4 protein(SSA-4))ã€Cathepsin D.They were sorted out from the serum of patients with pancreatic cancer, pancreatic benign tumors and healthy controls,which were conformed differently expressed in the serum among the three groups by using i TRAQ and nano-RPLC-MS/MS methods.In this research,we select insulin-like growth factor binding protein-2(IGFBP-2) to study it deeply from the level of m RNA and tissue.We adopt RT-PCR and En Vision Immunohistochemical methods to analysize its expression characteristics among pancreatic cancer group, the adjacent tissues of pancreatic cancer and pancreatic benign lesion group and normal group and to explore the correlation of clinical pathological factors and its potential value in the diagnosis and treatment of pancreatic cancer. Methods :1ã€This experiment is divided in three groups:pancreatic cancer tissue, pancreas benign lesions(including pancreatic stones, pancreatic pseudocyst of pancreas, insulin tumor surgery resection of pancreatic specimens),normal pancreas tissues(line of pancreas trauma of pancreas resection in 2 cases, of periampullary tumors, under the common bile duct segment of pancreaticoduodenal resection of tumor patients retained by the 6 cases of normal pancreas tissues),and each group includes 8 cases.Specimen collection is made by authorization of the ethics committee approval and informed consent of party.Pancreatic tissue are collected from the resection during operation, specimens are put into the frozen storage tube filled with RNA preservation solution, and immediately stored in-80 ℃refrigerator. 2ã€The detection of IGFBP-2 m RNA in the pancreas tissue: reverse transcription polymerase chain reaction(RT-PCR) method is used to detect IGFBP-2 m RNA and β-actin is used as reference gene.IGFBP-2 5’Primer :GTTGCAGACAATGGCGATGAC; IGFBP-2 5’Reverser : GTTCCTGT TGGCAGGGAGTC; β-actin 5’Primer : CACCGAGCATGGC TATAGGT; β-actin5’Reverser:AACCGCTCGTTGCCGATG 。 According to the sample standard curve and the PCR reaction Ct value, we use the Bio-Rad IQ5 software to analysize, and use 2-△△Ct to analysize the IGFBP-2 m RNA relative quantitative expression.3 〠Using En Vision Immunohistochemical staining method to detect the expression of insulin-like growth factor binding protein-2(IGFBP-2).Specimens are from liver and gallbladder surgery department from January 2009 to September 2014, the 40 cases are confirmed as pancreatic carcinoma by pathology after surgical resection..There is no chemoradiotherapy before operation.We also acquire the 40 paraffin specimens of pancreatic carcinoma tissue and their adjacent tissues and their complete case history materials, with normal pancreas as control.En Vision Immunohistochemical method is adopted to test the expression of IGFBP-2 protein in the three groups. We analysize IGFBP-2 positive expression according to the clinical medical records including patients’ age, gender, pathological differentiation, tumor size, TNM stage, lymph node metastasis or not and other statistical.In addition, we analysize IGFBP-2 positive expression when preoperative serum CA19-9>37u/ml.All the statistics data is analysized by SPSS17.0 software,we analysize the relationship between IGFBP-2 positive expression and clinical pathological factors by using chi-square test or rank and inspection, Spearman correlation analysis was used to analysize the correlation,the difference was statistically significant.(p<0.05).Results: 1ã€The results of RT-PCR:The relative expression quantity of IGFBP-2 gene m RNA in pancreatic cancer group(4.18±0.18)is significantly higher than the pancreas benign tumor group(2.10 ±0.18) and normal pancreas(1 ±0.08); 2 ã€Immunohistochemical results: IGFBP-2 express in the cytoplasm of pancreatic cancer tissue and the rate of the positive expression in the pancreatic cancer tissues is 92.5%, which is 40% higher than that of tissue adjacent to carcinoma, while it is not expressed in normal pancreatic tissue. What’s more, the difference between pancreatic cancer group and the tissue adjacent to carcinoma is statistically significant(X2=30.386,p=0.004).3ã€The relationship between IGFBP-2 positive expression and pancreatic cancer clinical pathology:IGFBP-2 expression in pancreatic cancer tissue is associated with the differentiation degree of pancreatic cancer tissue, low differentiation group is significantly higher than high differentiation of pancreatic cancer, the difference between the two groups has statistical significance(X2=10.321, p= 0.001); It is associated with nodal metastasis, the group with lymph node metastasis express higher than the group without metastasis, which is statistically significant(X2=26.694,p=0.000); It’s associated with TNM stage of pancreatic cancer, the expression quantity of IGFBP-2 is higher in the later stages than the early stages,and the difference is statistically significant(rank sum test, p=0.002);And it has nothing to do with age, sex and tumor size.4ã€The level of CA19-9 in the serum before operation has correlation with the positive expression of IGFBP-2,namely when the level of CA19-9 is over 37u/ml in the serum before operation,it expresses higher IGFBP-2 than ≤37u/ml group, and the difference has statistical significance.(X2=6.323, p=0.012). Conclusion:1〠Pancreatic cancer tissue can express insulin-like growth factor binding protein 2(IGFBP-2), which is obviously higher than that of benign tumor tissue and normal pancreatic tissue, and difference is statistically significant.2〠There is correlation between Insulin-like growth factor binding protein 2(IGFBP-2) and clinical pathological features, that’s to say the poor differentiation degree, the later TNM staging, or(and) lymph node metastases will lead to the higher expression of IGFBP-2, which has no relationship with age, sex and tumor size.3ã€IGFBP-2 is significant in the diagnosis of pancreatic cancer, and when combined with other pancreatic cancer tumor markers,for example CA19-9, it can provide important information for the diagnosis of pancreatic cancer. |