Gnt-V Affects The Sensitivity Of Radiotherapy In Small Cell Lung Cancer Cell Lines

1. IntroductionGlycosylation is a dynamic post-translational modification which changes during the development, progression and metastasis of various malignancies. Glycosyltransferases, located in the Golgi apparatus with a membrane-bound form, are released from cells after stimulate by certain proteases. It plays a very important role on the protein glycosylation and contains about six N-acetylglucosaminyltransferases (GnTs), named as GnT-Ⅰ-Ⅵ. GnT-Ⅴ is a key enzyme which catalyzes the formation of betal,6GlcNAc branching of N-glycans, and has been reported to play an important role in carcinoma proliferation, invasion and metastasis. GnT-V may be involved in tumor cell progression through different ways, including increased cell proliferation and inhibition of apoptosis in vivo. Studies have been shown that GnT-V was related with the expression of E-cadherin. Tt was an important sign function of epithelial-mesenchymal transition (EMT) which may be closely associated with distant metastasis of tumor cells. The current study shows that GnT-V play a different role in different cancer, such as highly GnT-V expression in liver cancer, breast cancer and colon cancer mean malignant performance. But some clinical studies about non-small cell carcinoma and bladder cancer found that low expression of GnT-V associated with a good prognosis.Lung cancer currently remains the most commonly diagnosed malignancy. Small cell lung cancer (SCLC) is the most aggressive subtypes that accounts for around20%of lung cancers. It is strongly associated with cigarette smoking and has a tendency for early dissemination with a dismal prognosis. Chemotherapy and radiation treatment can improve survival for many patients with SCLC, but it has initial responses nearly invariably followed by rapid recurrence of therapy-resistant disease leading to poor survival rates. Hence it is important to understand variations in practice and outcomes for these treatment strategies. Increasing evidence has implicated cell signal transduction pathway (PI3K/AKT/mTOR), proto-oncogenes (Bcl-2, MYC), and tumour-suppressor genes (p53, RB, PTEN) in the development of SCLC. There is no early detection strategy or targeted therapy currently available. So, the treatment of SCLC remains challenging, and it is important to research effective and feasible treatment targeting molecules associated with resistance.It was reported that GnT-V is closely related to the degree of malignancy and the relation between GnT-V and small cell lung cancer radiation therapy tolerated is still not clear. In this study, we obersed that down or up-regulation GnT-V expression would affect the sensitivity of radiotherapy therapy in small cell lung cancer cell line.2. ObjectPreviously, our team menbers had studied that down-regulation of GnT-V enhanced multidrug resistant small cell lung cancer cells (H69AR) radiosensitivity in vitro and in vivo. At the same time the possible mechanisms involved also be researched. However, whether up-regulation of GnT-V affect the sensitivity in small cell lung cancer radiation therapy or nor was still unknown. In this study, we used shRNA to construct low expression of GnT-V SCLC cell lines H1688/1079/sh, H1688/1564/sh, H146/1079/sh and H146/1564/sh, while we used MGAT5RNA to establish high expression of GnT-V SCLC cell lines H1688/mgat5and H146/mgat5in order to understand the difference between the nomal cells and the disturbed cells after radiotherapy in vitro.3. Materials and methods3.1. Cell culture and transfectionThe human small cell lung cancer cell lines H1688/H146were routinely cultured in RPMI-1640medium supplemented with fetal bovine serum (H168810%, H14615%, v/v) and all cells were incubated at37℃in a humidified atmosphere containing5%CO2. The pGPU6/GFP/Neo and GV230/EGFP/Neo MGAT5vectors were acquired from Shanghai GenePharma Co, Ltd. They were all constructed as described previously. The constructed plasmids were transfected into H1688and H146cells according to the instruction of the Lipofectamine2000TM (Invitrogen, California, USA). The stable transfectants cells were selected in RPMI-1640containing G418at400μg/ml or2000μg/ml and were named as H1688, H1688/NC/sh, H1688/1079/sh, H1688/1564/sh, H1688/NC/mgat5, H1688/mgat5, H146, H146/NC/sh, H146/1079/sh, H146/1564/sh, H146/NC/mgat5, H146/mgat5respectively.3.2. QRT-PCRTotal RNA from tumor cells were collected using Trizol reagent (Invitrogen, California, USA). The expression of GnT-V mRNA was detected by Quantitative Real Time Reverse Transcription-PCR analysis (qRT-PCR). Complementary DNA (cDNA) synthesis was converted from the mRNA by reverse transcription reactions. Real time reactions were performed using the SYBR(?) PrimeScriptTM RT-PCR Kit (Takara Biotechnology Co, Ltd) under the following conditions:30s at95℃for1cycle,5s at95℃,30s at60℃for40cycles,95℃for15s,55℃for45s, and95℃for15s for melting curve analysis. The expression level of GnT-V relative mRNA in each sample was evaluated using the comparative expression level2-△△Ct method. The PCR primers were as follows:GnT-V F:5’GAGCAGATCCTGGACCTCAG3’; R:5’GCTGTCATGACTCCAGCGTA3’; GAPDH F:5’GCACCGTCAAGGCTGAGAAC3’ R:5’TGGTGAAGACGCCAGTGGA3’3.3. Western blotCells with good condition were collected and lysed with cold RIPA buffer. Protein concentration of the supernatant was determined by the BCA protein assay procedure. The proteins were mixtured with loading buffer and heated at100℃for5minutes. Wet transfers were performed for100minute at100mA using PVDF membranes. And then the PVDF membranes were blocked with5%fat-free dry milk for2hours. The membranes were incubated overnight at4℃with primary antibodies (1:200-diluted antibody of GnT-V from abnova Taiwan;1:1000-diluted antibody of GAPDH), followed by incubation with horseradish peroxidase-labeled secondary antibody for an hour at37℃temperature, and then stained with ECL reagent. Protein bands were quantified by Image-Pro Plus6.0software.3.4. Cell Counting Kit-8(CCK-8) AssayTo understand the function of GnT-V in radiation sensitivity of H1688and H146cell lines, tumor cells were plated in96-well plates and radiated with a single dose of6Gy. After radiation, the cell survival situation were detected by CCK-8method at different times (Oh,24h,48h,72h and96h).10μl cck-8solution and100μl RPMI1640were added to each well. The cells were incubated for2h before reading the absorbency using a micro-plate reader at450nm.3.5. Scratch AssayH1688and H146Cells were plated in6-well plates and incubated till100%confluence was observed. A1mm linear "scratch" was made with a pipette tip and cells were radiated with a single dose of6Gy. Linear distance between cells on either side of the scratch was measured in9locations for each well. H1688cells were measured at Oh,12h and24h. While H146cells were measured at Oh,48h and96h.3.6. Clonogenic Survival AssayH1688Cells were cultured in six-well plates and radiated with photons (OGy,2Gy,4Gy,6Gy and8Gy) using a linear accelerator. And then cells were incubated at37℃with5%CO2until small cells aggregation could be obersed by eyes. It was about10days. At the end, cells were stained with0.1%crystal violet for colony counting. We only scored the colony containing more than50cells.3.7. Statistical AnalysisAll data were analyzed using SPSS13.0software. Results are showed using means±SD. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA) or factorial design analysis of variance. In all cases, P<0.05was considered as significant.4. Results4.1. Development of H1688and H146cells wtih down or up regulate GnT-VAfter being screened for one month under G418(400ug/ml or2000ug/ml), cells containing the recombinant plasmids were acquired by fluorescence microscopy (Fig.3-1A-B).The expressions of GnT-V mRNA in H1688/1079/sh and H1688/1564/sh cells were decreased by58%and66.9%compared with H1688respectively by qRT-PCR. The GnT-V protein in H1688/1079/sh and H1688/1564/sh cells compared with H1688were decreased by53.2%and58.8%respectively by western blot. The GnT-V expression levers in H1688/magt5cells were7.173times compared with H1688by qRT-PCR and1.805times by western blot (Table.3-1, Fig.3-2A,). The similar result could be observed in H146cell lines. The expressions of GnT-V mRNA in H146/1079/sh and H146/1564/sh cells were decreased by58.9%and49.6%compared with H146respectively by qRT-PCR. The GnT-V protein in H146/1079/sh and H146/1564/sh cells compared with H146were decreased by54.1%and44.9%respectively by western blot. The GnT-V expression levers in H146/magt5cells were3.157times compared with H1688by qRT-PCR and1.717times by western blot (Table.3-2, Fig.3-2B,). It was clearly seen that the expression of GnT-V at both the mRNA and protein level were changed successful after transfection.4.2. Change GnT-V expression affect the sensitizes of H1688and H146cells afer radiation via influence cell viabilityH1688/1079/sh and H1688/1564/sh were observed a significant reduction of cell viability at all four time point (24h,48h,72h and96h) following radiation compared with H1688and H1688/NC/sh. There was no significant difference in cell viability after radiation between H1688/1079/sh and H1688/1564/sh. This data suggesting that targeted inhibition of GnT-V could sensitize H1688cells to radiation, resulting in decreased cell viability. Whlie H1688/mgat5were observed a significant increase of cell viability at all four time point (24h,48h,72h and96h) after radiation compared with H1688and H1688/NC/mgat5(Table.3-3, Fig.3-3A,). The similar result could be observed in H146cell lines (Table.3-4, Fig.3-3B,).4.3. Change GnT-V affect motility of SCLC cellsThe movement of H1688/1079/sh and H1688/1564/sh were more slowly than those of the control groups at different time point (12h,24h) after radiation. There was no significant difference in cell migration after radiation between H1688/1079/sh and H1688/1564/sh. While The movement of H1688/mgat5were more fast than those of the control groups (Table.3-5, Fig.3-4A,3-4C). The similar result could be observed in H146cell lines (Table.3-6, Fig.3-4B,3-4D). All these results suggested that change of GnT-V expression impact the radiation-sensitivity, leading to affect the migration in SCLC cell lines.4.4. Change GnT-V expression affect clonogenic survivalSurvival fraction of H1688/1079/sh was lower than those of the control groups of H1688and H1688/NC, while similar to that of H1688/1564/sh after radiation, which indicated inhibition of GnT-V enhanced the radiation sensitivity of H1688cells. Survival fraction of H1688/mgat5was higher than those of the control groups of H1688and H1688/NC/mgat5that mean increase of GnT-V expression reduce the radiation sensitivity of H1688cells(Table.3-7, Fig.3-5A-B).Conclusion:1、The shRNA expression vectors aimed at GnT-V gene can inhibit the expression of GnT-V both in the level of mRNA and protein obviously in SCLC.2、GnT-V MGAT5targeting small cell lung cancer H1688and H146cell can increase the GnT-V mRNA and protein expression.3、Change of GnT-V can impact radiosensitivity of human small cell lung cancer cell in vitro. Inhibition of GnT-V enhances sensitivity of radiotherapy in SCLC. Up regulation of GnT-V decrease radiation sensitivity of SCLC.4、GnT-V may be a potential target for increasing radiation sensitivity in SCLC.