Font Size: a A A

Micrornas Deep Sequencing And Identification Of Aspergillus Fumigatus Infected Mice Lung Tissues

Posted on:2015-04-17Degree:MasterType:Thesis
Country:ChinaCandidate:F ChenFull Text:PDF
GTID:2284330431967604Subject:Internal medicine
Abstract/Summary:
BACKGROUND:Aspergillus fumigatus is the most common of fungi that cause of death in the world present, which widely found in nature, especially when in the soil, corruption of fruits and vegetables and construction waste, in the winter and rainy seasons and storage of straw mildew more. Inhalation of aspergillus spores is not necessarily pathogenic, but if a large number of inhalation or chronic diseases people with severe low immunity may cause severe invasive pulmonary aspergillosis (IPA). IPA is a serious opportunistic infections disease secondary to a weakened immune system, which usually found in patients with immunosuppression such as agranulocytosis, large doses of hormones and immunosuppressive agents, organ transplants and AIDS. Because of diverse clinical manifestations, diagnosis is difficult, poor efficacy, so IPA have a poor prognosis and high mortality. Studies indicate that the incidence of IPA is rising, and the mortality rate remains high recently, which shown that from1989to2003, the incidence of IPA of hematologic malignancies patients from0.9%to2.9%and the mortality rate increased to79.2%-82.0%.MicroRNAs (miRNAs) are a small single non-coding RNA molecules about19~25nucleotides and widely exists in all eukaryotes, which expression has sequence specificity and tissue specificity. After mature microRNA processing, through fully complementary or incomplete complementary binding with the target mRNA3’untranslated region (UTR) sequence, causes mRNA degradation or translational repression, Thereby negatively regulate the expression level of target genes at the post-transcriptional. miRNA play an important role in regulating the process of individual development, cell proliferation, apoptosis, and cancer, etc. Study found that miR-155mediate the generation of proinflammatory response early. let-7i and miR-125b could reduce the early immune response. miR-146expression in the late reaction is an important negative regulator of immune response factors, negative feedback can close TLR pathway. miR-21could improve anti-inflammatory response, promote IL-10production, and as IL-10on the inhibition of miR-155can further cause inflammatory reactions. Currently, there are studies of bacteria, viruses, Candida albicans infection which miRNA regulation of macrophage inflammatory response and found that miRNA can negatively regulate pro-inflammatory cytokine production and maintain immune balance. So far, whether Aspergillus fumigatus infection miRNA involved in the regulation is not clear. Therefore, this study screened pulmonary Aspergillus fumigatus infection associated miRNA involved in the regulation of Aspergillus fumigatus infection is innovative.This subject application HiSeq deep sequencing (depth of high-throughput sequencing) method to detecte the immunodeficient IPA mice and the immunodeficient non IPA paired samples of lung tissue. Referring to miRBase and Genebank databases, screening differentially expressed miRNA of IPA mice lung tissue (Differentially expressed miRNA is defined as:Fold-change>1or Fold-change <-1, and the p-value<0.01), then construction of IPA mouse lung tissue miRNA expression profile to explore their changes of expression in the development of IPA mouse; From the analysis of the difference between the level of miRNA expression correlation in IPA; Expand the sample size, the application of Real-time PCR method for detection of selected microRNAs greater than2-fold in immunodeficient IPA mouse lung tissue v.s. immunodeficient non-IPA mouse lung tissue expression of sequencing data to verify the reliability and accuracy of sequencing data.OBJECTIVE: 1Establish immunodeficient mouse model, then through endotracheal intubation drip spore suspension of Aspergillus fumigatus to establish mouse model of IPA infection and dynamic observation pathological changes in lung tissue, in order to provide in vivo IPA research and observation IPA development.2Trough the new generation of high-throughput sequencing technology HiSeq deep sequencing sequencing and bioinformatics technical, systematic analysis genomics of immunodeficient IPA mouse lung tissue miRNAs to build a miRNA expression profiling and screened differentially expressed miRNAs.3On the basis of identified miRNA, confirming the miRNA target site through target gene prediction software, and then through the point where the target gene GO functional annotation and KEGG pathway annotations, preliminary study IPA regulation target lay the foundation for IPA regulation mechanism research.SUBJRCT AND METHODS:1to establish a model of immunodeficient IPA mice1.1Establish a immunodeficient mouse model:C57BL/6J mice by intraperitoneal injection of cyclophosphamide250mg/kgX2times to build immunosuppression then orbital venous plexus blood neutrophil counts.1.2Establish a IPA mouse model:Cutting a small hole of0.3cm in the neck of mice under anesthesia, and isolating trachea and inoculating clinical isolates of Aspergillus fumigatus8×106or PBS25μl every mouse; Dynamic observation of mice general, survival, pulmonary fungal load, lung tissue in general and hematoxylin-eosin (HE) staining. Pulmonary fungal load was detected by real-time PCR to measure Aspergillus fumigatus18s rRNA (GenBank accession number AB008401), using a standard curve quantitative Aspergillus fumigatus spores.2High-throughput sequencing and bioinformatics analysis of mouse lung tissue miRNA IPA methods establish:2.1Sample collection:Collected3IPA immunodeficiency IPA mice lung tissue (labeled25-3d,26-3d, and27-3d) and3immunodeficiency non-IPA mice lung tissue (labeled25-0d,26-0d and27-0d). 2.2Total RNA extraction and identification:total RNA were isolated according to the user of instruction of Trizol. The concentration of RNA was determined using nucleic acid quantitator. The purity of total RNA was analyzed by15%denaturing polyacrylamide gel and Agilent Bioanalyzer. The three Od mouse lung tissue samples total RNA were equal mixed and three3d mouse lung tissue total RNA samples were detected by agarose gel electrophoresis, and judging the quality of the sample according to preliminary results of electrophoresis.2.3cDNA library construction:the18-30nt small RNAs were isolated from total RNA and the3’and5’termini of RNA molecules are joined with special adapters respectively. In the clips to the joint as a template with six arbitrary primers synthesized cDNA, the subsequent addition of5’end of adapter primer and3’end primers for PCR amplification, thereby to complete the preparation of the library.2.4HiSeq deep sequencing sequencing:Using sequencing by-synthesis method (SBS-sequencing by synthesis), minus some regions as lack of secondary structure. Accessed to millions of small RNA sequences once, rapid and comprehensive identification of small molecule RNA of immunodeficient IPA mouse lung tissue and discover new miRNA, construction of small RNA expression profile differences between samples.2.5Information Analysis:HiSeq sequencing obtained50nt sequence through exclude fitting, eliminate low quality, eliminate pollution and other processes to complete the data processing to obtain high quality tags, and then Inter-sample sequence length distribution statistics and common sequence statistics. After puts the Clean up high quality tags classified notes, obtained the information contained in the sample and the information expressioned.2.6Known miRNA identification and new miRNA prediction:After all the small RNA fragments annotated, the not annotated fragments using the SOAP software to:1. novel miRNA prediction;2. known miRNA base edit forecast.3Identification and analysis of immunodeficient IPA mouse lung tissue miRNAs expression profiling:3.1Analysis the differences of miRNA expression:According HiSeq sequencing results, statistical three immunodeficient IPA mouse lung tissue miRNA expression, and then Od as a reference, using log2-ratio, Scatter plot diagram, comparing the miRNA expression differences on the three groups.3.2By Real-time PCR method to detect the screened more than2times microRNAs in immunodeficient IPA mouse lung tissue and immunodeficient non-IPA mouse lung tissue expression,and verified the reliability and accuracy of sequencing data.4Prediction of target genes:by RNAhybrid software to prediction the verified miRNA target sites, and then through the point where the target gene GO functional annotation and KEGG pathway annotations, preliminary study the regulation IPA targets.RESULTS:1Intraperitoneal injection of cyclophosphamide250mg/kg at-3d and-1d before infection and significantly reduced peripheral blood neutrophils. From the day of infection to4d, the number of neutrophils were consistently lower than100/ul. Campared with the control group, PBS group and IPA group neutropenia were significant (p<0.05), and neutropenia reached immunodeficiency standard.2we anesthetized mice by intraperitoneal injection with chloral hydrate and intratracheal administration A. fumigates conidia, which resulted in100%mortality by4days post-challenge in IPA mice; highest A.fumigatus burden in IPA mice at1day post-challenge, and with time prolong, A.fumigatus burden reduced; lung tissue in general can visible hemorrhage and white nodules hyperemic gradually increased in IPA group, where the white nodules were A. fumigates infection foci; Hematoxylin and eosin (H&E)-staining staining of lung tissue sections revealed that the vascular congestion, edema, inflammatory cell infiltration, alveolar hemorrhage were gradually increasing, and the normal alveolar structure gradually disappeared after infection.3Application HiSeq deep sequencing (high-throughput deep sequencing) methods to analyze the expression of three immunodeficient IPA mouse v.s. paired immunodeficient non-IPA mouse lung tissue. Combined this data, we have analyzed these differences miRNA expression variation in IPA and found that a total of23miRNAs were identified to be defferentially expressed between IPA and control, and in which there were14miRNAs up-regulation and9miRNAs down-regulation, suggesting that these miRNA closely associated with the occurrence of IPA. There are8miRNA expression more than2fold, in which6expressed more than2fold (mmu-let-7b-3p, mmu-miR124-3p, mmu-miR21a-3p, mmu-miR29c-5p, mmu-miR3473b, mmu-miR3473e) and2miRNA expressed less than2fold times(mmu-miR-150-3p, mmu-miR-503-5p). we also found a Novel miRNA between three immunodeficient IPA mouse v.s. paired immunodeficient non-IPA mouse lung tissue(candidates2AATGTGGAAGTGGTCTGAGGCAT) and which didn’t registered in the miRBase database.4By expanding the sample size (IPA=20, control=20) for the eight expression higher than2-fold difference miRNA use Real-time PCR method be validated and found that the eight differentially expressed miRNA were all statistically significant. This expression consistent with the sequencing results, we can see, the sequencing data are credible.5Through the eight verified miRNA target genes predicted, We found that different miRNA, the number of target genes whose butt is not the same, there may be zero, there also may be thousands, For example, mmu-let-7b-3p target gene are2, while mmu-miR-3473e target genes have352, The number of genes differentially expressed miRNA docking more. Those abnormal expressed genes may be closely related to the regulation of miRNA. In the development of the occurrence of IPA, regulating the difference of gene expression of micrornas vary, they express mechanism also not nearly the same, may give priority to some micrornas and multiple micrornas participation is complementary.CONCLUSIONS:1After intraperitoneal injection of cyclophosphamide build immunodeficiency state, we tracheotomy drip into the aspergillus spores suspension to establish immunodeficiency mice model that typical pathological changes conforms to IPA, and found that excessive inflammatory reaction is the important cause of death in animals. This for further treatments and prevention of IPA provides the basis.2We are on the same immunodeficiencient IPA mouse lung tissue and matched immunodeficiencient non-IPA mouse lung tissue significant differences miRNA expression research and prediction of target gene, Preliminary reveals the miRNA expression rule in IPA, further clarify the molecular mechanism of IPA, Looking for early effective diagnosis and biological molecules marker of disease progression provides adequate theoretical basis.
Keywords/Search Tags:Invasive Pulmonary Aspergillosis, agranulocytosis, mouse, HiSeqsequencing, microRNA
Related items