H3K27Dimethylation Changes During BMDLSC Differentiaton Towards Hepatocytes From Rats In Vitro

Bone marrow derived liver stem cell (BMDLSC) refers to a mesenchymal-stem cell with the potential to differentiate into hepatocyes in the bone marrow. The adult stem cell originates from the non-embryonic which is an important extra-hepatic source of hepatocytes and has multi-potential to self renew and directionally differentiate into hepatocytes under special conditions. BMDLSC is more advantageous over ESC because of extraction convenience, simple separation techniques, culturing can easily be done in vitro and provides a cheaper research alternative. There are currently many studies being undertaken which involve inducing rats’ bone marrow stem cell to differentiate into hepatocytes in vitro. However the special regulation mechanism of differentiation is unclear.Research show that epigenetics plays an important role in regulation of stem cell renewal and differentiation, other factors coupled with differentiation which display an assignable effect include tissue regeneration, aging, DNA injury and repair and tumor genesis.Epigenetics consist of DNA methylation, histone modification, chromosome remodeling to mention a few. Histone modification includes methylation, acetylation, phosphorylation, ADP-ribosylation. The relationship between biological function and these modifications and their combination in time and space, serve as an important epigenetic markers or languages, so called histone code. The same residual histone phosphorylation versus dephosphorylation, acetylation versus deacetylation, and methylation versus demethylation, different residual histone phosphorylation versus acetylation, ubiquitylation, methylation, plosplorlation, the mutual coordinates and opposites between them and histone modification form a complicated regulation net, of which the changing of histone H3modification is particularly prominent in the regulation of cell differentiation and development. Early study has shown that histone methylation and eukaryotes transcriptional activation have a close relationship. Most of histone methylation occur in the lysine(K) or arginine(A) at the nitrogen end of H3and H4, such as9th and27th lysine in H3,8th and20th lysine in H4and so on. Histone-lysine methylation depends on different histone lysine methyltransferase to catalyze. Lysine residue methylation could be mono-methylation, di-methylation, tri-methylation(mel/me2/me3) respectively according various degrees of methylation at different locations. The methylation of histone amino acid residue acts a critical character in activation or silencer of gene transcription in embryo stem cells, affecting the process of cell development. The H3K27me2methylation level of target gene promoter could be decreased via the function of H3K27demethylase, thus relief gene suppression and enhance expression. Pan discovered that H3K27methylation and H3K4methylation could affect transcription factor in the study of human embryonic stem cell (ESC) differentiation, changing of methylation modification could suppress or activate gene expression in the process of human ESC early differentiation, affecting differentiation process. There are other related researches that also confirmed a tightness relation between H3K27methylation and transcriptional promote site. Pasini showed that the removing of Polycomb group (PcG) protein (a set of transcriptional repressor of regulation target gene by chromation modification) could definitely decrease the H3K27me2 expression in ESC, and finally cause many developmental gene upregulation. At present there are few studies about the changing of BMDLSC histone modification. Whether or not histone H3K27me2exists and plays a role in the regulation function of BMDLSC differentiation into hepatocyte in vitro this has not been reported.The study performed the rat BMDLSC which separated and purificated that directional differentiated into hepatocyte in vitro, and Western blot was applied to observe dynamically the H3K27me2expression level during different time in the process of differentiation, which illustrated the changing of H3K27me2during the process that BMDLSC induced differentiation into hepatocyte in vitro for providing theoretical basis of regulation mechanism of the BMDLSC differentiation.Material and Method1.1Experimental animal30male Vista rats with weight90-100g and aging5-6weeks were purchased in Southern Medical University Experimental animal centre, cleaning, living under SPF class condition.1.2Reagent One-Step RT-PCR semi-quantitative detection kit(TaKaRa), Thy-1mark mice resist rat anti-body, lineage cell depletion kit(Miltenvi Biotee), hepatocyte growth factor(PeproTech EC),10%fetal bovine serum(Invitrogen), DMEM medium(dry powder)(Invitrogen), FITC mark goat resist rabbit anti-body(Beijing Bioss), Anti-Histone dimethyl-H3K27(Abcam).1.3Method1.3.1Seperation of BMDLSCExtract tibia and femur in sterile condition before wash marrow cavity repeatedly, then add the cell suspension with marrow cell2:1volume into Percoll which density is1.077kg/L. After centrifugation and collenting the surface membrane layer of separation liquid, centrifugate again, remove supernatant, wash with PBS buffer and count the cells. 1.3.2Purification of BMDLSC by magnetic activated cell sorting and determination of the purity by flow cytometryUsing magnetic activated cell sorting(MACS), at first separate negative from cell suspansion by lineage cell depletion kit and Thy-1mark mice resist rat anti-body, which is selecting Lin(-)cells (CD5、CD45R(B220)、CDllb、Gr-1(Ly-6G/C)、7-4、 Ter119negative cells)from suspension, and then separate Thy-1(+)Lin(-)BMDLSC from Lin(-)cells.1.3.3induction and culturing of BMDLSCCultured the marrow stem cell from last step in6pore plate with covered by25ng/ml fibronectin. Nutrient solution include high glucose DMEM/F122.5%,10%fetal bovine serum,20mmol/L Hepes,10-7mol/L hexaeadrol with penicillin and streotintcin, and changed as high glucose DMEM/F122.5%with25ng/ml hepatocyte growth factor(PeproTech EC),20mmol/L Hepes and10-7mol/L hexaeadrol with penicillin and streotintcin to induce differentiation after cell adherence. Changed nutriet solution per3day and observe the cell type. Induced continuously14days, respectively, recorded typical cell type and remain enough sample in0th,7th,14th day, repeat cases was5.1.3.4Detection the hepatocyte special mark ALB and AFP mRNA by RT-PCRExtracted the whole RNA in0th,7th,14th day, reversed to get cDNA following specification steps and detected ALB, AFP by RT-PCR(according the method of kit instruction). ALB primer:upstream was5’atcctgaaccgtctgtgtgt3’and downstream was5’cagttatccttgtcggcagc3’. AFP primer:upstream was5’gcgcatccatttccttcctt3’and down stream was5’tctaaacacccatcgccagt3’. The experiment was by β-actin as internal reference, normal marrow stem cells without induction of rat was adopted as control group. Got5μL from PCR products, electrophoresis analyzed products fragment in3%sepharose gel, compared the change of ALB,APF mRNA expression in each period.1.3.5Detection of H3K27me2expression by Western blotExtracted protein by lysis buffer RIPA from cells collected in0th,7th,14th day, boiling water warm3-5min after added appropriate protein surface buffer to sufficient degenerate the sample. Extracted20μL sample protein to separate by10%SDS-PAGE and then trarsmembran. Applied TBST5%skim milk powder to block membrane and hatched by primary anti-body Anti-Histone dimethyl-H3K27(1:200) pass the night in4℃refrigerator. In next day, washed membrane3times(10min per once) with TBST, later coordinated with goat resist rabbit anti-body(1:1000) to hatched1hour in indoor temperature, then wash membrane3times(10min per once) and color imaging by ECL at last.1.3.6Detection of H3K27me2expression by immunofluorescenceTook the marrow stem cells in0th,7th,14th day to inoculate into6bore plate, removed medium after adherence and washed cells with PBS. Fixation with4%poly formaldehyde in20min, transparent disposing by PBS with0.5%Triton-X-100in15min, washed cells with PBS(10min per once) after each steps. Applied TBST5%skim milk powder to block membrane and hatched by primary anti-body Anti-Histone dimethyl-H3K27(1:200) pass the night in4℃refrigerator. In next day, washed membrane3times(10min per once) by PBS with0.1%Tween-20in indoor temperature, later added goat resist rabbit anti-body(1:1000) to hatched1hour protection from light indoor. Removed second anti-body, added DAPI staining15min or more in normal temperature, after washing membrane3times(10min per once) by PBS with0.1%Tween-20, observed in fluorescence microscope.1.4Statistical analysisPreformed SPSS17.0to deal with the result. The grey value ratio calculation applied one-way ANOVA, homogeneity of ariace between groups difference applied LSD, while unhomogeneity in groups applied Dunnett T3. P values<0.05for the difference is statistically significant.2. Result2.1Morphologic changing of BMDLSCThe more uniform spherical mononuclear cells were obtained by isodensity centrifugation and separated out BMDLSC by MACS. By the flow cytometry instrument detection, the proportion of Thy-1surface mark attained99.63%, while CD45was only0.79%. Under microscopic observation, multinuclear fiber cells that presented long rod primary could be found before induction. Cells became shorten and thicken generally compared with0th day, presented polygons and long fusiform in7th day and further shorten presented such circular and short spindle in14th day.2.2The purity of BMDLSC showed byflow cytometryFlow cytometry suggested that the purity of Thy-1cell is99.63%, expressing cell the purity of CD45cell is0.79%.2.3The ALB, AFP mRNA expression of BMDLSC in different differentiation timeRT-PCR detected ALB mRNA content of target cell that separated by MACS, did not see obvious band. ALB mRNA expression increase evidently and the electrophoresis banding showed clear in7th day. In14th day, the content of ALB mRNA was more increase obviously than7th day, and the electrophoresis banding highlight hinted ALB mRNA expression was more higher. Plotting according the grey value ratio of ALB mRNA banding and internal reference β-actin as Y axis and induction time as X axis, as you see ALB mRNA expression presented increasing trend entirety. The difference of groups of ALB mRNA grey value ratio between0th,7th and14th day was statistical significance (P<0.05).RT-PCR detected AFP mRNA content of target cell that separated by MACS, did not see obvious band. ALB mRNA expression increase evidently and the electrophoresis banding showed clear in7th day. In14th day, the ALB mRNA expression was decreasing than before, but still higher obviously compared with0th day. Plotting according the grey value ratio of AFP mRNA banding and internal reference β-actin as Y axis and induction time as X axis, as you see AFP mRNA expression presented rising after falling trend entirety. The difference of groups of AFP mRNA grey value ratio between0th,7thand14th day was statistical significance (P<0.05).2.4The expression level changes of H3K27me2in different differentiating timeWe performed Western blot to test H3K27me2expression level. The H3K27me2expression level of target cells that were separated without inducing was extremely low whereas expression increased in7th day, and in14th day more increasing obviously than7th day. Plotting according the grey value ratio of H3K27me2and internal reference P-actin as Y axis, and inducing time as X axis, we can see the expression of H3K27me2presented increasing trend entirety, hinting H3K27me2increased along with BMDLSC differentiation, the difference of groups between0th,7th and14th day was statistical significance (P<0.05). The result of immunofluorescence figure was similar with Western blot, which H3K27me2expression showed a clear rising trend.Conclusion1. BMDLSC differentiate towards into hepatocyte by inducing in vitro, and H3K27dimethylation level increased gradually in the process of differentiation.2. H3K27dimethylation modification may involve the regulation of the process that BMDLSC differentiate into hepatocyte.