Font Size: a A A

Prokaryotic Expression Of Recombinant Golgi Membrane Protein73(GP73), And The Vitro Selection And Identification Of Aptamer Against GP73

Posted on:2013-08-03Degree:MasterType:Thesis
Country:ChinaCandidate:Y Y CaiFull Text:PDF
GTID:2284330362469755Subject:Clinical Laboratory Science
Abstract/Summary:
Objective: To construct the prokaryotic expression vector pET32a(+)-GP73andpurify recombinant protein-GP73, generate specific aptamer against GP73through atechnique of Systematic evolution of ligands by exponential enrichment(SELEX)detection, detenime the binding rate of specific aptamer against GP73,and use theaptamer in clinical immunohistochemistry, establish a platform of SELEX for GP73,make the foundation for the flowing research.MethodsOne: the construction of prokaryotic expression vector pET32a(+)-GP73andpurification of recombinant protein-GP73(1)According to the open reading frame of GP73, design correspondingprimer,amplificate GP73gene by PCR;(2)connect the product to pMD-19T and transforme the plasmid into DH5α,pick out the positive strains, extract pMD19-T-GP73plasmid.(3)After confirmed by DNA sequencing, get GP73fragmanets by cutting gelafter double digests, insert the fragments into plasimid pET-32a(+) to constructrecombinant plasmid pET-32a(+)-GP73.The recombinant plasmid was transformedinto BL21, and expressed GP73;(4)Regulate the concentration of IPTG as0.2mmol/L、0.6mmol/L、 1.0mmol/L respectively, and adjust the induction time as2h、4h、6h,, analyse bySDS-PAGE, choose the optimum condition to be experimental condition, then useNi-NTA affinity chromatography to purify GP73, and assay it concentration by GP73ELISA KitTwo:the construction of random oligonucleotide pool and the generation ofspecific aptamer against GP73(1)Synthesis oligonucleotide pool with the full length of85bp, whichcontaining a randomized45nucleotides in middle region and20bp constant regionwhich is used to design primers in both terminals,the whole capacity is reach at454;(2)Take GP73as target molecules, and incubated in a96-well plate, set blankcontrol with BSA, put the ssDNA that not connect with blank control into theinculbated well, after washing perform PCR with biotin marked lower primer,makethe ssDNA into dsDNA with biotin;(3)Put the product of PCR with magnetic beads,one of the dsDNAwas markedby biotin could combine with avidin which was on the magnetic beads, when addalkaline solution,dsDNA turned into ssDNA, left the library ssDNA in the solutionwhile the biotin marked ssDNA was still on the magnetic beads, collect the solutionand obtain the ssDNA as a next pool;(4)incubate the next pool with target protein again. After iterate selectioncycles, aptamers can be generated,about6-12selection cycles,the aptamer againstGP73can be enriched, and the affinity can be saturated, and then stop selection.Three:Using Ap marked DIG system to test the binding rate of aptamer poolagainst GP73in diffenent cycle(1)Keep oligonucleotide pool of cycle1、3、5、6、8and10, perform PCRwith DIG marked upper primer and biotin marked lower primer,make the ssDNA intodsDNA with biotin and DiG respectively, and use magnetic bead and frame system toobtain the DIG marked ssDNA;(2)Incubation the ssDNAwith GP73, after washing add antiAP-DIG, colorateby PNPP, assay the405nm outcome after the termination reaction by microplate reader;(3)According to the result,,sequencing and analyze the proper pool of somecycle,(4)find the fittest ssDNA as the aptamer against GP73through the secondarystructure analyses, use the method of noncompete ELISA to detect the affinityconstant of the aptamer against GP73.Four:blocking and immunohistochemistry experiment to test the bindingspecificity of aptamer against GP73.(1) GP73was incubated in a96-well plate, dilute the GP73polyclonalantibody into different concentration, and then incubate with GP73, after washing, puta certain concentration of aptamer into each well, analyse whether the polyclonalantibody can block aptamer ‘s ability to bind GP73(2)Marked the aptamer with biotin, use it in clinical immunohistochemistry,and analyse whether the aptamer can bind GP73in human normal hepatic tissue ofbile duct and the Hepatocellular carcinoma tissueResults:(1) PCR amplified1200bp gene which was consistent with the theoretical value, andconnect the product to pMD-19T, there was no mutation after DNA sequencing.(2) Get GP73fragmanets by cutting gel after double digests, constructed theexpression vector pET-32a(+)-GP73successfully.(3)IPTG induction, the SDS-PAGE showed a68Kd target protein in supernatant,correspond with expected values(4)Using Ni-NTA affinity chromatography to purify GP73,and got a single lineof GP73,Western blot prove that the recombination GP73could combine with thepolyclonal antibody,and the concentration of the GP73was2μg/ml;(5) Monitored the pool of cycle1、3、5、6、8and10, found that with theincreasing number of select cycle, the combination between ssDNA pool and GP73 was geting enrichment, from0.057to0.612, when6、8、10cycle, the affinity was notincreased obviously as the former cycles, and the result were0.528、0.579、0.612thatmeans the affinity was saturated, then stop selection;(6) Pick cycle6、8and10to clone and sequencing,found a group of the samesequence in6and10respectively, as aptamer6-25and aptamer6-35:ACGCTCGGATGCCACTACAGTTGATTTTTTCGTTTTGTTTAGATTGTTTCCGTGTCTTTATGTTGCTCATGGACGTGCTGGTGAC(italic represent the random45bp region),as aptamer10-2and aptamer10-3:ACGCTCGGATGCCACTACAG*********************************************CTCATGGACGTGCTGGTGAC (italic represent the random45bp region);(7) Using the uncompetition ELISA method which is to test affinity constant ofmonoclonal antibody, to explor the aptamer’s affinity constant range as:(3.96±1.86)×103M-1;(8) When the concentration of GP73polyclonal antibody was at the rage of1;500to1:1000,the effect of blocking was well showed, binding ratio were0.057and0.083, when out of this rage,the ratio were from0.083to0.52,which was on the otherside proved the specivicty binding between aptamer and GP73。ConclusionIn the research, the GP73gene fragment successfully amplified, recombinantprotein-GP73was expressed successfully in Prokaryotic cell,and get a single line ofGP73after purification; Synthesis oligonucleotide pool to generate a specific aptameragainst GP73,during the selection, the binding affinity was increased from0.057to0.612, when to6、8、10cycle, the affinity was not increased obviously as the formercycles as0.528、0.579、0.612respectively, Pick cycle6、8and10to clone andsequencing,found a group of the same sequence in6and10respectively, chose theaptamer10-2to test affinity constant of monoclonal antibody, to explor the aptamer’saffinity constant range as:(3.96±1.86)×103M-1,the average of dissociation constantwas250nmol/L which meaned lower dissociation constant more practical; Used theaptamer in clinical immunohistochemistry,this put the foundation for the subsequent experiment that use the SELEX technique in clinical serologic of GP73test.
Keywords/Search Tags:recombinant protein-GP73, pool, Systematic evolution of ligands by exponentialenrichment (SLEXE), magnetic beads, affinity constant, immunohistochemistry
Related items