Font Size: a A A

Quick And Accurate Detection And Quantification Of Botryosphaeria Dothidea In Branch Tissue Of Peach Using QPCR

Posted on:2017-03-10Degree:MasterType:Thesis
Country:ChinaCandidate:H ZhangFull Text:PDF
GTID:2283330485975702Subject:Pomology
Abstract/Summary:
Peach tree gummosis was one of the most predominant disease that could harm the main trunks, branches and twigs of peach trees which leaded to unhealthy development of peach trees, and influenced fruit quality and production. The previous research showed that three Botryosphaeria species were identified to be able to cause peach tree gummosis, namely, Botryosphaeria dothidea, B. obtuse and B. rhodina, among which, B. dothidea was the most widely distributed one; B. rhodina was only detected in Shayang County, Jinmen City, Hubei Province; B. obtuse in Gong’an County, Jinzhou City, Hubei Province. B. dothidea was identified as the predominant specie that could cause peach tree gummosis. There is a lack of fast and reliable system detecting peach tree gummosis disease, therefore, the present study aims to established a reliable q PCR method to detect the pathogens in the lesion tissue with specie-specific primers of B. dothidea. The main results are as follows:1. This research based on modified CTAB method. We had changed the procedure of DNA extraction of the peach branch tissue. Frist, we used the tissuelyser machine instead of grinding samples with liquid nitrogen to increase the efficiency of DNA extraction. Second, we added a step of centrifuging after the water bath heat-treatment to reduce the mixture of DNA extracts. DNA extracts did not contain PCR inhibitors. 1. Based on the modified CTAB method, we found a more suitable method for DNA extraction of peach branch tissue. First, instead of manually extraction with liquid nitrogen, tissue grinding machine was used for DNA extraction to increase the extraction efficiency. Second, after 30 min of heating treatment in water bath, the samples were centrifuged to reduce PCR inhibitors, the results showed that the DNA quality was high and there was no PCR inhibitors in DNA extracts.2. We designed the primer pairs EF1/ER2 with species specificity. Multiple comparison was made among the β-tubulin sequences of strains of B. dothidea, B. rhodina, B. obtusa isolated from peach tree tissues with the symptom of gummosis and other Botryosphaeria spp. strains uploaded in the Genbank. The primer set EF1/ER2 was designed with the software Primer Premier 5.0.Forward primer EF1: 5’ TCATTCTCAGCGTGGGAGAACA 3’Reverse primer ER2: 5’ ACGAGGAACGTACTTGTTGTTGGA 3’ BLAST analyses at the genbank was conducted to confirm that the primers could not generate any nonspecific amplification and no similar sequences detected in any other species. We used the strains of B. dothidea, other strains of Botryosphaeria spp. and some common pathogens in the peach tree such as Monilinia fructicola, Colletotrichum higginsianum, Botrytis Cinerea to prove the specificity of primers through the conventional PCR and the q PCR. We sequenced the amplicons of samples in the field with the specific primers and found that the sequences of amplicons is consistent with the sequence used for designing the primers.Strain WH-2 of B. dothidea was selected and a 10-fold dilution series of its total DNA were used to determine the sensitivity of primers with the method of absolute q PCR and conventional PCR. The results showed that the least limit of the conventional PCR was 10 pg while the least limit of q PCR was 1 pg. q PCR was about 10 times more sensitive than the conventional PCR.3. We established the linear relation between Ct and initial amounts of DNA extracts of the pathogen. The standard curve contained the slope of-3.086, with R2 of 0.9943. Peach TEF2 was taken as reference genes and β--tubulin gene of B. dothidea as the target genes(specific primer pair EF1/ER2). The △Ct method was used to determine the relative content of B. dothidea in host tissues.
Keywords/Search Tags:peach tree gummosis, Botryosphaeria dothidea, Specificity primer, q PCR, molecular detection
Related items