CRISPR/Cas9 Mediated FGF5 Gene Knockout In Inner Mongolia Cashmere Goat Fetal Fibroblast | | Posted on:2017-01-05 | Degree:Master | Type:Thesis | | Country:China | Candidate:J X Li | Full Text:PDF | | GTID:2283330485966437 | Subject:Biological engineering | | Abstract/Summary: | | | The Inner Mongolia Cashmere goat produces quaility cashmere, which enjoys high reputation in the world. How to improve the cashmere production always been a important task of the cashmere goat breeding, molecular breeding provides a new method for breed improvement. The RNA mediated CRISPR/Cas9 system has been adapted as an effeicent genen-targeting technolgy, which include a non specific Cas9 nuclease and a set of programmable sequence specific guide RNA. The sequence specific RNA guide Cas9 to cleave DNA and generate double - strand breaks at target sites. Subsequent cellular DNA repair process leads to desired in sertions, deletions or substitutions at target sites. Fibroblast growth factor 5 is an important growth factor that affect the hair follicle cycle and hair growth and control the transformation of hair follicle from the growth stage to a resting phase. Knock-out of FGF5 gene promote the growth of cashmere by deregulating the hair follicle growth cycle. In this study, we designed the specifics sgRNA target to cashmere goat FGF5 gene and predicted the potential off-target sites of the sgRNA, then constructed CRISPR/Cas9 specific expression vectors target to cashmere goats FGF5 gene。 The constructed CRISPR/Cas9 vector target to cashmere goat FGF5 gene were transfected into Inner Mongolia Cashmere goat fetal fibroblast by the electrotransfection. The FGF5 Knock-out effect were examined by surveyor assay and sequencing and the results showed that the knock-out happened at cashmere goat FGF5 gene. Then the single cell was picked up randomly from transfected cells by FACS and subculture 7-20 days to get several clones. The FGF5 gene knock-out Inner Mongolia Cashmere goat fetal fibroblast cell lines were selected by sequencing form these clones.We obtained 79 potential sgRNA which target to cashmere goat FGF5 gene by biological information analysis and chose 2 of 79 sgRNA as the the target site which named FGF5-1 (AGAAGCGCCTCGCACCCAAA) and FGF5-2 (CCCTGCCTCCTCCTCCTCCG). The two sgRNA sequence were synthesised and inserected into the pX330 vector to get the FGF5 special CRISPR/Cas9 vector named pX330-FGF-1 and pX330-FGF5-2. The sequencing results showed that the vector was constructed correctly.The constructed FGF5 gene konck-out vector pX330-FGF5-1 and pX330-FGF5-2 were transfected into the Inner Mongolia cashmere goat fetal fibroblast by electrotransfection. The results of surveyor assay and sequencing showed that two constructed FGF5 gene konck-out vector worked well and the FGF5 gene were cleaved in transfected cells.24 cell clones were obtained by FACS selection and subculture and 4 FGF5 gene konck-out cell lines from these 24 cell lones were seclected by sequencing with no mutations at potential off-target site.In summary, the CRISPR/Cas9 expression vector targeting FGF5 gene of Inner Mongolia Cashmere goats were constructed and transfected into the Inner Mongolia Cashmere Goat Fetal Fibroblast by Electroporation. The 4 FGF5 gene konck-out cell lines were established by surveyor assay and sequencing examintation. This study will promote to further breed new strains of Inner Mongolia white cashmere goats with commerical quality and quantity by cloning technology. | | Keywords/Search Tags: | Fibroblast growth factor 5, CRISPR/Cas9 system, knock-out, single cell clone, Inner Mongolia Cashmere Goat Fetal Fibroblast | | Related items |
| |
|