Screening Candidate Genes Associated With Chicken Serum IgY Content By Targeted Resequencing

The screening and identification of functional genes for disease resistance traits had been a hot topic in modern poultry breeding research. This study based on the previous Genome-wide association study (GWAS) results of significant locis which affected IgY antibody trait, conducted capture resequencing by using the capture chip and Hiseq2000 high-throughput pooling sequencing method.Beijing-You (sample number 728) and White Leghorn (sample number 525) were selected as the materials, chose high and low IgY content individuals 40 each, consisting of two varieties and 4 phenotype treatment groups. DNA samples of each group were randomly equally divided into 4 double hybrid repeats, each containing 10 individuals (pool). A total of 35154 SNPs were obtained,28862 of which were homozygous mutations,6292 were synonymous mutations; in the CDS region,1045 SNPs were synonymous mutations,2190 SNPs could cause amino acid change; 18332 SNPs were located in the Gene region. A total of 829 indel sites were obtained, most of which were located in the mRNA region.Four genes TRIM7.2, BFIV21, AKIP and RBL2 were selected, covering all of SNP sites regions obtained by next generation sequencing, resequencing by conventional Sanger methods. A total of 24 SNPs were obtained by pooling sequencing, containing 21 SNPs found in the next generation sequencing method, this result confirmed the results obtained by the capture sequencing method were reliable. A 9 bp base deletion (CCACTGCCA) in BF1 gene and 26 bp base insertion (ATGGGGATGGTGTGGGGACAGAAGAC) in C4 gene were selected and verified by the polymerase chain reaction PCR-Sanger method conducted in Beijing-You Chicken and White Leghorn Chicken. The 9 consecutive nucleotides (CCACTGCCA) deletion of BF1 gene result proved to be successful, and the missing was the common mutation found in the two varieties of high IgY phenotype population.The indel of BF1 gene intron 5 polymorphisms were detected, results showed that, in the Beijing-You and White Leghorn Chicken capture sequencing samples, there were three genotypes in the indel region, the wild type (9 bases all exist, AA), mutation type (9 base which contains three mutations, BB), deletion type (missing all the 9 bases, CC), the content of IgY in different genotypes were AA<BB, CC, but the difference were not significant(P>0.05), two varieties had the same change trend. Polymorphic typing in White Leghorn chicken B19 and B21 haplotype groups, there were only two genotypes:AA and BB. The polymorphic loci mutation found in vulnerable Marek’s disease groups (B19) was genotype AA, the anti-Marek’s groups (B21) was genotype BB, each genotype frequency was 100%.BF1 gene can affect the specific binding of class I antigen and antigen peptide, the results of this study showed that the mutations of 9 bp base (CCACTGCCA) were likely to cause differences in alternative splicing of BF1 gene or BF1 gene expression, then playing a role in poultry IgY antibody formation and Marek’s disease resistance.