Font Size: a A A

Phylogenetic Analysis Of Rhizoctonia Solani From Potato And The Rapid Identification Of Their Anastomosis Groups

Posted on:2015-12-03Degree:MasterType:Thesis
Country:ChinaCandidate:C Y ZhangFull Text:PDF
GTID:2283330467962827Subject:Plant pathology
Abstract/Summary:
Black scurf and stem canker caused by Rhizoctonia solani is a kind of soil-bornefungal disease on potato and widely occurs in potato production areas in the northernChina,causing the great damage to both quantitative and qualitative of potato tubers. Inthis study, the composition of the vegetative compatibility groups of seven anastomosisgroups (AGs) were determined, pathogenicity of different AGs were tested, thephylogenetic analysis of Rhizoctonia solani was evaluated with rDNA-ITS and TEF-1αsequences and the specific-primers of Cytb were designed to develop a fast molecularidentification method for determing the different anastomosis groups of Rhizoctoniasolani from potato. The main results are summarized as follows:1. To determine the composition of vegetative compatibility groups (VCPs) ofRhizoctonia solani from potatoes in Hebei and Inner Mongolia,104Rhizoctonia solanistrains from two provinces were selected in this study. The result showed that there fiftyVCPs occurred in total. The group AG3-N was predominant (11.32%of total isolates),followed by AG3-F (4.81%) and AG3-A (3.85%), while other vegetative compatibilitygroups were comprised of the lower frequency (0.96~2.89%).2. The soil inoculation was used to test the pathogenicity of19strains from7anastomosis groups. The study indicated that the tested anastomosis groups of Rhizoctoniasolani except binucleate Rhizoctonia AG-A were capable of causing lesions on potatostems. The isolates of different AGs and VCPs exhibited different levels in their virulences.The result showed that AG-3was the most virulent on potato, followed by AG4and AG5,AG2-1, AG9and AG1-IB were the weekness in virulence. The color of symptoms onunderground stem of AG3strains was darker than other AGs, and the lesion area was alsolarger.3. ITS sequences of7different AGs isolates were analysized. The result indicated thatthe5.8s rDNA sequence were completely conserved across all the AGs examined, whereasthe ITS rDNA sequence was found to be highly variable among isolates, and the sequenceof ITS1was more divergent than that of the ITS2region. The sequence homology in theITS regions was92.1~99.9%for isolates within an AG, and84.2~96.3%for isolates ofdifferent AGs. AG4were grouped into three sub-groups, ITS sequence of AG4HG-I andAG4HG-Ⅱ were more homology than AG4HG-Ⅲ. These results suggest that sequenceanalysis of ITS rDNA regions of R. solani may be a valuable tool for identifying AG andsubgroups.4. The pair of primer of TEF-1α (TEF1α-RSF: CGTGAYTTYATCAAGAACATG/TEF1α-RSR: GACTTGACTTCAGTGGTCAC) was designed by aligning sequences of basidiomycota from NCBI database. The length of PCR product was about680bp. Thesequence analysis result showed that the sequence homology in the Tef-1α regions was92.4–99.9%for isolates within an AG, and85.2~93.9%for isolates of different AGs. Aphylogenetic tree was inferred on the basis of the45TEF-1α sequences, which topologicalstructure was basically the same to the phylogenetic tree of ITS, with slightly different onbootstrap. The amino acid sequences of TEF-1α were the same within an AG, while thereexited13different sites between different AGs. The results suggest that the TEF-1α regionsof R. solani could identify anastomosis groups and subgroups efficiently.5. The pair of primer of CytbRS-F/CytbRS-R was designed by aligning sequences ofAG3and AG1-IB, with550bp~1000bp of PCR products. The Cytb gene was amplifiedwith this primers among the anastomosis groups AG1-IB, AG2-1, AG3, AG4-HGⅡ andAG5effectively. The five AGs, which common were isolated from potato could beidentified through the agarose gel electrophoresis, based on the length of PCR products.
Keywords/Search Tags:Rhizoctonia solani, vegetative compatibility groups, pathogenicity, rDNA-ITS, TEF-1α, Cytb
Related items