Font Size: a A A

Identification Of MicroRNAs In Antennae Of Malehelicoverpa Armigeraafter Larvae Treated With Mixed Biopesticide Bacillus Thuringiensis-abamectin

Posted on:2015-01-16Degree:MasterType:Thesis
Country:ChinaCandidate:P Z ChenFull Text:PDF
GTID:2283330467452248Subject:Plant protection
Abstract/Summary:
Antenna plays an important role in insect mating, breeding, migration, and other acticities. Thereare varieties of proteins exist in the antenna of insect that involved OBP, PBP, ORs, ODE. On account ofthese proteins which are related to the olfactory system, insect would have different kinds of behaviorsthrough a series of complicated pathway.MicroRNAs(miRNAs) areendogenous non-coding~22nt smallRNAs that play gene-regulatory roles throughpairing to the mRNAs ofprotein coding to directtheirposttranscriptional repression in animals and plants.Helicoverpa armigera is a agricultural pest whosemating and breeding mostly happens at night by a way that male moth receive and take actions to thesex pheromones releasing by female moth. In this thesis, we analyzed and identified three groups ofmiRNA involed MA(intennae from male moth at night), MA_D(intennae from male moth in day time)and BtA(intennae from male moth fed with Bacillus thuringiensis and Abamectin mixture at night) bydeep sequencing. After variance analysis, we predicted the target gene and its function that mayregulated by miRNA we found. In this way, we want to found some new miRNA and miRNA atvariance that can regulate the olfactory system for controlling pests.The miRNA and their distribution of expression in MA and MA_D were partly similar while BtAhas lower amout and reads in miRNA expression (there are only10miRNA in the reads of0-1). Weconclude that what makes this phenomenon happen is the Bacillus thuringiensis and Abamectin mixtureand the reduction mainly concentrated on the low reads miRNA.The let-7family is confirmed to regulate the immune system in insect body. In this thesis, we findlet-7is up-regulated in the BtA and make the conclusion that BtA can make an effect on immune system.Another two miRNA families,mir-276and-1000whose major predicted-targets encoding neuralfunction related genes are enriched in the insect optic lobes and brain. So we conclude that the twomiRNA would influence some behaviors between BtA and MA.2potential novel and7conservative miRNA that with high reads were predicted to regulate theolfactory system. There are4miRNA that have a50%fold change compairing MA_D with MA.Combine with previous study about the mating circadian rhythm in male moth, we conclude that thesemiRNA may possibly influence this rhythm by regulating the olfactory-gene. It’s obviously to see that8miRNA have a50%fold change compairing BtA with MA, involving an important miRNA,mse-mir-252(CTAAGTACTAGTGCCGCAGGAG) that regulate several olfactory-gene in predicted.This miRNA is up-regulated in the BtA with0.61in Log2(BtA/MA). So, we also conclude that thesemiRNAs maybe the reason why varianceexist in BtA by regulating the olfactory-gene in some ways thatwe didn’t know.
Keywords/Search Tags:Helicoverpa armigera, male moth, antenna, MicroRNA, Solexa deep sequence, targets recognition, functions of target gene
Related items