Cloning Analysis And Investigation Of Relationship Between Serine Carboxypeptidase Gene And Yolk Protein In Bombyx Mori | Posted on:2016-07-16 | Degree:Master | Type:Thesis | Country:China | Candidate:L P Wang | Full Text:PDF | GTID:2283330464451342 | Subject:Special economic animal breeding | Abstract/Summary: | PDF Full Text Request | Carboxypeptidase is one of important insect digestive enzymes.So far, only a small amount of serine carboxypeptidase(SCP) from the insects have been described, from Bombyx mori have not yet relevant research reports. Depending on the different tissues and organs, serine carboxypeptidase performe vary functions that include the digestion of food an, synthetic neuroendocrine peptides,and so on.In this paper, Serine carboxypeptidase gene was a significant different expression gene in normal temperature and high temperature,which was screened based on the analysis of silkworm SAGE library.It was identified and cloned from the fat body of silkworm,then its gene sequences was analysed by bioinformatics. The gene expression regularity of different developmental stages under a normal, and high-temperature conditions was investigated, as well as the relationship between the SCP and the yolk protein.1. The c DNA Cloning and analysis of the novel serine carboxypeptidase gene SCP in Bombyx moriSAGE expression library that was constructed by the two organizations of silkworm larvaes under high temperature and room temperature in the lab is screened to get a low expression of tag(CATGGTGCCGCGGGACCAGCC) from female silkworms under high temperture, the gene accession number BGIBMGA012773-TA is searched in the silkworm genome data(http: //www.silkdb. org / silkdb /) according to targeted gene annotation information of SAGE library. By PCR and RACE technique, the full-length m RNA sequence is predicted 1416 bp extended to 1671 bp, 3’RACE is extend the 85 bp, the longest ORF 1416 bp, predicting longest ORF length is 1416 bp. Construction of phylogenetic tree analysis shows that Bm SCP of silkworm, which has relatively distant evolutionary relationships with other insects SCP, is closest relationship with EHJ78980.1 of Danaus plexippus and forms the same branch with it. Protein sequence alignment analysis among Bm SCP of Silkworm, SCP protein of higher vertebrates and other insects found that SCP active sites are higher conservative whether higher vertebrates or insects, there are more amino acids similar sites, and it indicates that SCP is a higher protein conserved in the long process of evolution and has high similarity among the species. Seeing from the gene expression in the three days of fifth instar of larval tissues that is different with EST expression spectrum, Bm SCP is expressed not only in fat body but also in many tissues.The gene is not reported serine carboxypeptidase gene(SCP) of the silkworm by preliminary identification.2 Expression and specificity analysis of Bm SCP in Bombyx mori under heat treatmentm RNA is extracted from the fat body and midgut of different genders of silkworm which is raised during the fifth instar under normal and high temperature. The expression of Bm SCP from different genders, tissues and conditions of silkworms is surveyed by quantitative PCR. The results shows that the expression of Bm SCP of heat group in fat body of female silkworms were significantly different than normal group of female silkworms on day 3 larvae of the 5th instar, there are significant differences in males on day 5 larvae of the 5th instar. However, heat group compares with the normal group in midgut of Bombyx mori, males and females, respectively, which are significant differences on on day 7 larvae of the 5th instar and day 3 larvae of the 5th instar. The above results indicate that Bm SCP is a sensitive gene to high temperature and is more sensitive in fat body of female silkworms than in midgut of female silkworms, fat body and midgut of male silkworms.Whether silkworms are raised under hot or at room temperature, the expression of Bm SCP has significant gender differences in fat body of silkworm, which means that the gender difference was not directly related to rearing temperature. However, the expression of Bm SCP does not exist significantly gender differences in midgut of silkworm, which speculates that there are special functions in fat body of female silkworm, the function is related to store and transform nutrients that stuff is required to generate eggs in terms of female silkworm.Expression of Bm SCP in tissues on different developmental stages of silkworm analysis showed that there are significant differences in tissues of females and is also highly expressed in midgut during the fifth instar, which is proved that Peter speculates Serine carboxypeptidase plays digestive function in midgut of insects each other.3 The relationship between Bm SCP gene and Yolk protein in Bombyx moriSilkworms have a total of eight days from laying to forming their eggs. Analysis among ovary, Yolk protein content of eggs and expression of Bm SCP gene, whose results shows that YP fluctuation is consistent with expression of Bm SCP, These results indicated that SCP gene and its corresponding enzyme involved in the synthesis of YP. We also found transcriptional expression of SCP is consistent with YPR in fat body of female silkworm on the fifth instar stage. We speculate SCP and its corresponding enzyme, which maybe synergies with Vg R gene, not only involved in the synthesis of yolk protein but also modification and transport of yolk protein precursor. | Keywords/Search Tags: | Bombyx mori, high temperature, expression profile, Bm SCP gene, yolk protein | PDF Full Text Request | Related items |
| |
|