The Construction And Identification Of The Lentivirus Vector With MyD88siRNA And TRAMsiRNA Of Mucaca Mulatta

[Object]To construct the lentivirus vector with MyD88siRNA and TRAMsiRNA of mucaca mulatta and to identify and package it by infecting293T cells.[Methods](1)To get the eukaryotic plasmid vector of with MyD88siRNA of mucaca mulatta and the eukaryotic plasmid vector of with TRAMsiRNA of mucaca mulatta by connecting four pairs of siRNA and the eukaryotic plasmid vector.(2)To get the overexpression eukaryotic plasmid vector of target genes with MyD88and TRAM of mucaca mulatta by connecting target genes with MyD88and TRAM of mucaca mulatta and the eukaryotic plasmid vector.(3) The overexpression eukaryotic plasmid vector of target genes with MyD88and TRAM of mucaca mulatta transfect293T cells and to detect the expression both by Western blot.(4)To co-transfect293T cells by the eukaryotic plasmid vector of with MyD88RNAi of mucaca mulatta and the overexpression eukaryotic plasmid vector of target genes with MyD88of mucaca mulatta and the eukaryotic plasmid vector of with TRAMRNAi of mucaca mulatta and the overexpression eukaryotic plasmid vector of target genes with TRAM of mucaca mulatta,then to screen effective the eukaryotic plasmid vector of with MyD88RNAi of mucaca mulatta and the eukaryotic plasmid vector of with TRAMRNAi of mucaca mulatta by Western blot.(5)To get the lentivirus vector with MyD88siRNA and TRAMsiRNA of mucaca mulatta by connecting the eukaryotic plasmid vector of with MyD88RNAi of mucaca mulatta、the eukaryotic plasmid vector of with TRAMRNAi of mucaca mulatta and the lentivirus vector, then to package it by infecting293T cells after PCR.[Result]We get the MyD88siRNA sequence of mucaca mulatta is GAGGAAGAAAGTCGTGGCTTT and the TRAMsiRNA sequence of mucaca mulatta is AAGTACAAGGCAATGAAGAAA and construct lentivirus vector with MyD88siRNA and TRAMsiRNA of mucaca mulatta successfully by connecting them with lentivirus vector.[Conclution]To construct lentivirus vector with MyD88siRNA and TRAMsiRNA of mucaca mulatta successfully by siRNA and lentivirus vector,and to establish the experiment foundation of using them to infect the immature dendritic cells and of studying the liver transplant tolerance of mucaca multta further.