The Effects Of IFN-γ Promoter Polymorphism And MHC Haplotypes On Avian Influenza Vaccination In Gallus Gallus

H5N1serosubtype Avian influenza lead to highly pathogenic avian influenza virus(HPAI), which is an important infectious disease to economic value of livestock and globalpublic health significance. So far, the mainly strategies of prevention and control thisdisease are vaccination to healthy animals and Culling infected animals, the former doesnot apply to migratory birds and cannot deal with the new virus variants, the lattereconomic cost is too expensive. Against the interferon γ (IFN-γ), as a cytokine, which canbe represented a broad spectrum anti-viral in the level of cellular immunity, and diseaseresistance genes Major histocompatibility complex(MHC), which is recognized havehighly polymorphic alleles in to date. This research choice red jungle fowl (Gallus gallus)as experimental animals, which is reported in the literature have disease resistance to HPAI.We immune the HPAI subtype H5N1inactivated vaccine, specific antibody in the bloodplasma were titrated by the hemagglutination inhibition (HI) test, the promoter region ofIFN-γ gene were amplified using the polymerase chain reaction (PCR)+1technique fromgenomic DNA, Single nucleotide polymorphisms (SNPs) were determined by clone andsequencing. Chi-squared test was employed to analyze whether the allele frequencies ofappropriate SNP was in Hardy-Weinberg equilibrium. The least squares analysis wasconducted to determine whether the frequency of particular SNP genotype is associatedwith log2transformed HI antibody titers (LSMean±SE). Meanwhile PCR amplification todetermine MHC haplotype at microsatellite differentiated points LEI0258and MCW0371.Consequently, there were33SNPs detected in red jungle fowl IFN-γ promoter region, The bird sample for the-316A/G SNP genotypes was an increasing tendency in the HI antibodytiters with the substitution of allele G by allele A so that a significant increase occurred inthe AA genotype(8.00±0.252) when compared to the GG genotype (6.57±0.539)(P=0.0196<0.05), But AG genotype (n=23) antibody titer (7.74±0.298log2) were notsignificantly different with two genotypes above.30alleles and36haplotypes have beenfound by microsatellite amplification in LEI0258, which B4(16/58), B14(10/58),B18(15/58), B12.3(7/58) type is dominant type. Sequencing found that they are containingsix complex repeating unit:(AAGGAAAGAAAG)n,(TGTAGTACGTG)n,(GGGAATTCCCTTACC)n,(CCTTCTTTCTTT)n,(TG)n,(CAAAAAAATCACCACAAAATGAGCCTGAATGTTTGCACTGAGGATGGAGCACAGCTCA)n. MCW0371sites containingvariable number of large segments and continuously (T)n,(G)n,(C)n,(A)n. Analysis ofvariance with single factor was not found a correlation between the HI antibody titers andhaplotypes, but the dominant type of most individuals involved in this experiment showedhigher antibody titers. Analysis of variance with single factor was not found a correlationbetween the HI antibody titers and haplotypes, but the dominant type of most individualsinvolved in this experiment showed higher antibody titers. IFN-γ promoter-316A allelemay be stronger of anti-AIV than the individual with the G allele. Because of the identicalMHC genotype samples less than normal, so that they did not reflect the advantages MHChaplotype as markers of potential anti-HPAI.