Object: Apelin is the endogenous ligand of G protein-coupled receptor APJ. HumanApelin is encoded by APLN gene, and Apelin-APJ system play roles in regulation ofcardiovascular function, fluid homeostasis and insulin secretion balance. The subjectwas prediction of microRNA within apelin encoding gene APLN introns andprediction of its target genes, then annotate its functionsMethods:1. Prediction of precursor miRNAs: Used SVMbagging classifier to predictpre-miRNAs from APLN introns sequences;2. Prediction of mature miRNAs: Used MatureBayes to predict the mature miRNAsfrom precursor miRNAs;3. miRNAs homology: Used BLAST to align the predicted miRNA and existingprecursor miRNAs and mature miRNAs;4. Prediction of miRNA targets: Used PITA program to predict the targets gene ofmature miRNAs;5. Functional Annotation: Used DAVID software to analysze miRNA relatedfunction and signaling pathways; Used STRING server to analyze interaction ofproteins encoded by miRNAs target genes.Results:1. Prediction results show that279-360nt of Apelin gene intron1encoded82ntprecursor miRNA;2. The predicted precursor can formate two mature miRNAs,miR-apl-3p(14-35):GAGGCGGGGGACATGCCCGCTC,miR-apl-5p(52-73):GAGGCGGGGGACATGCCCGCTC;3. BLAST results show that the predicted pre-miRNA is homology withhsa-mir-3960and hsa-mir-3648sequence, miR-apl-5p is homology withhsa-miR-4674and hsa-miR-202-3P, miR-apl-3p is homology with hsa-miR-940;4. PITA prediction results show that there were99target genes for miR-apl-5p, such as GAB2, DBF4B,NTN1and676target genes for miR-apl-3p, such as SLC25A1,COMTD1, KIF21B;5. DAVID analysis results show that miR-apl-5p involved in the skeletal system,nervous system, lumen and lymphoid organ development and ossification andother biological progresses; miR-apl-3p target genes involved in cell morphology,cytoskeleton, cell motility and cell differentiation, involved in transcriptionalregulation, regulation of protein phosphorylation process, involved in ossification,bone development and skeletal system, involved in synaptic transmission, axonguidance, involved in phagocytosis, B cells and other immune system functions,involved in chemokine, VEGF, GnRH receptor signaling pathway, it’s alsorelated with thyroid cancer and lung cancer and other cancers. STRING resultsshow that there were interactions between BCL2L2and BCL2L11, KLC1andIFT172, BMP7and IGFBP5, which were encoded by miR-apl-5p target gene; andthere were ubiquitous interactions among miR-apl-3p target genes encodingproteins.Conclusions:1. The introns of Apelin gene may encode new miRNAs, which were namedmiR-apl-5p and miR-apl-3p respectively.2. The predicted miRNAs, target genes of miR-apl-5p and miR-apl-3p enriched inApelin-related biological process and signal pathways, such as bone, nervous andimmune system function, cytoskeleton, cell differentiation, synaptic transmission,regulation of transcription and many other biological processes and involved inthyroid cancer and lung cancer. |