| 1. IntroductionThe (31,6-branched oligosaccharides expressing on the surface of glycoproteins play important roles in carcinogenesis and participate in the regulation of the tumor biological characteristics. N-acetylglucosaminyltransferase V (GnT-V), located in the Golgi apparatus, is a key enzyme in the formation of (31-6branching of asparagine (N)-linked oligosaccharides. GnT-V was reported to be over-expressing in many malignant tumors, such as breast cancer, colon cancer, and hepatocarcinoma. A variety of studies have shown that GnT-V is strongly linked to carcinoma proliferation, invasion, and metastasis. These functions are performed mainly through the oligosaccharides modulation of cell surface receptors such as integrin, cadherins, and the growth factor receptors. Besides, a secreted type of GnT-V induces tumor angiogenesis without mediation of glycosylation. However, some studies showed that low GnT-V expression is associated with shorter survival and poor prognosis in non-small cell lung cancer and bladder cancer.Prostate cancer (PCa) currently remains the most commonly diagnosed malignancy and is one of the leading factors causing tumor related death in males. Radiotherapy is an important treatment choice for locally prostate cancer. However, recurrence and poor prognosis in many prostate cancer patients was always found because prostate cancer cells can easily become radio-resistant. Patients with high-risk characteristics (serum PSA>20ng/ml,>clinical T2, and Gleason score>7) will have more than50%chance of biochemical and clinical relapse after radiotherapy. Higher radiation doses (>70Gy) could improve radiotherapy effect but with increased toxicity to neighboring normal tissue. Hormonal deprivation is a sensitizing strategy, however long-term hormonal deprivation might induce hormone-resistant prostate cancer cells with radiation resistance [1]. So, neither increasing radiation doses nor sensitizing strategies are widely used. Some biomarkers for radiation sensitivity including Raf kinase inhibitory protein, PAK6, and DAB2IP gene have been reported. However, a reliable and convenient biomarker for PCa radiation sensitivity has not been identified. Thus, novel biomarkers are needed to improve radiation sensitivity of PCa.Although the roles of GnT-V in many tumors have been studied, the relationship between GnT-V and malignancy of PCa has not been reported. The Tissue Microarrays (TMAs) was used in this study to detect the relationship between GnT-V and clinical pathological features in85cases of PCa tissues and5cases of prostatic hyperplasia. The possible implications of GnT-V expression in PCa tissues were further accessed from the clinicopathological point of view. To clarify the role of GnT-V in radiation sensitivity of human prostate cancer PC3cell line, GnT-V was stably inhibited in PC3by a shRNA strategy. The effects of GnT-V down expressing on the PC3radiation sensitivity were assessed both in vitro and in vivo. Besides, the possible underlying mechanisms by which GnT-V affected radiation sensitivity were also studied.2. Materials and methods2.1. Cell culture and transfectionPC3was provided by the cell bank of Sun Yat-Sen University. The cells were cultured in RPMI-1640containing10%new bovine serum, and1%penicillin/streptomycin at37℃, with5%CO2.The pGPU6/GFP/Neo GnT-V/1079(plasmid of antisense GnT-V cDNA), pGPU6/GFP/Neo GnT-V/1564(plasmid of antisense GnT-V cDNA) and pGPU6/GFP/Neo GnT-V/NC (control plasmid) were constructed as described previously. The constructed plasmids were transfected into PC3cells by Lipofectamine2000TM (Invitrogen, California, USA). The stable transfectants were selected in RPMI-1640containing G418at1000μg/ml, and named as PC3GnT-V/1079, PC3GnT-V/1564, and PC3GnT-V/NC, respectively.2.2. PCR and Western BlotTotal RNA was harvested from cell and tumor tissue using Trizol (Invitrogen, California, USA). Levels of GnT-V mRNA were detected by Quantitative Real Time Reverse Transcription-PCR analysis (qRT-PCR). Reverse transcription reactions were proceed for15min at37℃, followed by5s at85℃for complementary DNA (cDNA) synthesis. Real time reactions were performed using the SYBR(?) PrimeScriptTM RT-PCR Kit (Takara Biotechnology Co, Ltd) under the following conditions:30s at95℃for1cycle,5s at95℃,20s at60℃for40cycles,95℃for0s,65℃for15s, and95℃for0s for melting curve analysis. The PCR primers (Shanghai Sangon Biotech Co, Ltd) were as follows: GnT-V F:5’GAGCAGATCCTGGACCTCAG3’; R:5’GCTGTCATGACTCCAGCGTA3’;(3-actin F:5’GAAACTACCTTCAACTCCATC3’; R:5’CGAGGCCAGGATGGAGCCGCC3’. The relative mRNA expression level of GnT-V in each sample was calculated using the comparative expression level2-△△Ct method.Cells were harvested and lysed with cold RIPA buffer. Protein concentration of the supernatant was determined by the BCA protein assay procedure. The proteins were prepared with loading buffer and heated at100℃for5minutes. All the samples were run on8-15%Tris-Glycine gels. Semi-dry transfers were performed for an hour at75mA using polyvinylidene difluoride membranes. After being blocked with3%BSA+7%fat-free dry milk, the membrane was incubated overnight at4℃with primary antibodies(1:200-diluted antibody of GnT-V,1:200-diluted antibody of bax, and1:300-diluted antibody of bcl-2,1:200-diluted antibody of bcl-xl, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubation with horseradish peroxidase-labeled secondary antibody (Beijing Biosynthesis Biotechnology Co, Ltd) for an hour at room temperature, and then stained with ECL reagent. Protein bands were quantified by Quantity One.2.3. Clonogenic Survival AssayCells were plated in six-well plates and radiated with photons (0,2,4,6, and8Gy) using a linear accelerator (Clinac2300C/D; Varian, United States). Incubated at37℃with5%CO2for21days, the cells were stained with crystal violet for colony counting. Only colony containing more than50cells was scored.2.4. Cell Counting Kit-8(CCK-8) AssayCells were plated in96-well plates (5000cells/well) and radiated with a single dose of6Gy. At different times (0,24,48,72, and96h) following radiation,10μl cck-8solution and100μl RPMI1640were added to each well. The cells were incubated for an hour before reading the absorbency using a micro-plate reader at450nm.2.5. Cell Apoptosis AssayCells were plated in six-well plates and radiated with doses of OGy and6Gy. Seventy-two hours after radiation, the morphological alterations of apoptotic cells were observed by fluorescence microscopy using Hoechst33258staining.Cells were plated in six-well plates and radiated with doses of OGy and6Gy. Floating and attached cells were harvested at72h post-radiation. The cells were washed with phosphate buffered saline (PBS), and resuspended in binding buffer containing7-AAD for10minutes, followed by the addition of Annex in V-PE. Cell apoptosis analysis was carried out using a flow cytometer (BD Biosciences, Oxford, United Kingdom).2.6. Caspase-3Activity AssayCaspase-3activity was assayed using the caspase-3colorimetric assay kit (Biovision, USA) according to the manufacturer’s instructions. Cells were radiated with single dose of6Gy. Cells were harvested at24,48and72h post-radiation, then the protein was extracted and diluted with cell lysis buffer. The reaction buffer (80μl) was added to each sample. The10μl DEVD-pNA (2mmol/L) substrate was added to the sample and incubated at37℃for2hours. Samples were read at405nm in a micro-plate reader. Fold-increase of caspase-3activity in PC3GnT-V/1079was observed in comparison to PC3and PC3GnT-V/NC.2.7. Cell Cycle AnalysisPC3cells were plated in six-well plates and radiated with four single radiation doses (0,2,6, and10Gy). Floating and attached cells were harvested at24h post-radiation, then cells were fixed in70%ethanol. After being washed with PBS, the cells were treated with PBS containing RNase. Next,50μg/ml PI was added for10min at37℃followed by flow cytometry analysis of cell cycle (BD Biosciences, Oxford, United Kingdom).2.8. In vivo Tumorigenicity AssaysForty-eight male nude mice (three weeks old, weighing18-20g, from the Animal Institute of Southern Medical University, Guangzhou, China) were used in the following assays in vivo. The mice were raised under specific pathogen-free conditions. Animal experiments were performed under the regulations of the institutional ethical commission (Southern Medical University).Cells were harvested, washed with PBS and resuspended in RPMI1640. Forty-eight nude mice were randomly divided into three groups for PC3, PC3GnT-V/NC, and PC3GnT-V/1079cells, respectively. Cells (5×106) in RPMI1640were subcutaneously inoculated into the legs of nude mice to establish the tumor model, respectively. Tumors were measured in two dimensions with calipers and the volumes were estimated using the following calculation:(major axis)×(minor axis)×(minor axis)×1/2. Radiation was delivered to tumors during consecutive5days (2Gy×5) using a linear accelerator as described previously when the tumor volume reached to200-300mmJ. Growth curves of the tumors after radiation were constructed. Twenty-one days later,6mice of each group were sacrificed and tumors were excised. Furthermore, expression of GnT-V in tumors from each group was detected by qRT-PCR, western blot assay and immunohistochemistry. Expression of bcl-2, bax, and bcl-xl proteins in tumors were detected by western blot assay and immunohistochemistry. The other10mice of each group were used to carry out a survival study. Survival rates were recorded and a survival curve was constructed. 2.9. Immunohistochemical AnalysisThe harvested tumors from each group described previously were embedded in paraffin after they were placed in10%formalin for24hours. Paraffin slides were deparaffinized in xylene, and rehydrated in graded ethanol. The tissues were rinsed twice with PBS, and endogenous peroxidase was blocked using3%hydrogen peroxide for15min. The tissues were washed thrice with PBS and blocked for15min at room temperature with animal non-immune serum. The tissue was incubated for2h at room temperature with primary antibodies(1:200-diluted antibody of bax,1:300-diluted antibody of bcl-2, and1:300-diluted antibody of bcl-xl, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubated with secondary antibody for10min at room temperature, and then stained with DAB solution. Finally, the tissues were counterstained with hematoxylin, dehydrated, and mounted with Permount. The tissues were observed under the microscope.TMAs were obtained from Cybrdi, Shanxi ChaoYing Biotechnology Co., LTD. The TMAs consisted of85cases with TNM stage and histological grade (well differentiated, moderate differentiated, poor differentiated) and5prostatic hyperplasia cases. Specimens were deparaffinized and rehydrated routinely. Before adding the primary antibody, antigens were retrieved by heating sections in10mM citrate buffer (pH6.0) in a microwave oven for10min followed by10min of cooling. After blocking nonspecific binding with0.3%H2O2and goat serum, the slides were incubated with a primary antibody directed against GnT-V (1:200), and subsequently incubated with a peroxidase conjugated rabbit anti-goat secondary antibody. Reaction products were visualized by3’-diaminobenzidine (DAB), and slides were subsequently counterstained with hematoxylin. The percent positivity was scored as0if<5%(negative),1if5-30%(sporadic),2if30-70%(focal) and3if>70%(diffuse) of cells stained, whereas staining intensity was scored relative to the known positive and negative controls as0if no staining,1if weakly to moderately stained and2if strongly stained. The GnT-V expression levels were classified semiquantitatively based on the total scores of the percent positivity and the staining intensity as follows:’negative if the sum scored0,’GnT-V low’ if the sum scored1,’GnT-V moderate’if the sum scored2-3and’GnT-V high’if the sum was4-5. The scoring procedure was taken by two independent observers without any knowledge of the clinical data.2.10. Statistical AnalysisData were analyzed using SPSS13.0software. Results are presented using means±SD. Comparison of means between two samples was perfonned using Student’s t test. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA), and then multiple comparisons were performed using least-significant difference (LSD). In all cases, P<0.05was considered statistically significant.3. Results3.1. Development of PC3cells inhibition GnT-VAfter being screened for one month under G418(1mg/ml), cells containing the recombinant plasmids were harvested by fluorescence microscopy (Fig.1).The expression of GnT-V mRNA in PC3GnT-V/1079and PC3GnT-V/1564cells were decreased by78.3%and66.8%compared with PC3, respectively by qRT-PCR. The GnT-V protein in PC3GnT-V/1079and PC3GnT-V/1564cells compared with PC3was decreased by73.8%and57.9%respectively by western blot. It was confirmed that the expression of GnT-V at both the mRNA and protein level in PC3GnT-V/1079and PC3GnT-V/1564cells were decreased when compared with the control groups of PC3cells and PC3GnT-V/NC cells (Fig.2, Table.1).3.2. Inhibition of GnT-V decreases clonogenic survivalSurvival fractions of PC3GnT-V/1079were lower than those of the control groups of PC3and PC3GnT-V/NC, and similar to those of PC3GnT-V/1564after radiation (Fig.3, Table.2), which indicated inhibition of GnT-V enhanced the radiation sensitivity of PC3cells.3.3. Inhibition of GnT-V sensitizes PC3cells to radiation, resulting in decreased cell viabilityPC3GnT-V/1079and PC3GnT-V/1564showed a significant reduction of cell viability at all four time points (24,48,72, and96h) following radiation compared with PC3and PC3GnT-V/NC. There was no significant difference in cell viability after radiation between PC3GnT-V/1079and PC3GnT-V/1564. This data suggesting that targeted inhibition of GnT-V could sensitize PC3cells to radiation, resulting in decreased cell viability.(Fig.4, Table.3)According to the results of CCK-8assay and Clonogenic survival assay described previously, it was found that pGPU6/GFP/Neo GnT-V/1079plasmid reduced the GnT-V mRNA and protein expression more efficiently than pGPU6/GFP/Neo GnT-V/1564plasmid, however, there was no difference in survival fractions and cell viability. There was only about10%difference both in mRNA expression and in protein expression between PC3GnT-V/1079and PC3GnT-V/1564. The gap in the knockdown extent was not big enough to result in the difference of radiation sensitivity between PC3GnT-V/1079and PC3GnT-V/1564. So, PC3GnT-V/1079cells were chosen for the further assays.3.4. Inhibition of GnT-V increases radiation-induced apoptosisApoptotic morphology, characterized as nuclear condensation and fragmentation, was observed in PC3GnT-V/1079cells using fluorescence microscopy before radiation, however there was negligible apoptosis for PC3and PC3GnT-V/NC cells, Apoptotic morphology was observed in PC3, PC3GnT-V/NC, and PC3GnT-V/1079cells after radiation, and the apoptosis rates in PC3GnT-V/1079group was more than the control groups by Hoechst33258staining (Fig.5A).The apoptosis rates in PC3GnT-V/NC and PC3GnT-V/1079were (1.52±0.43)%and (8.81±0.63)%before radiation,(9.21±0.23)%and (21.39±1.72)%at72h after radiation by flow cytometer (Fig.5B,Table.4). There was only about7.35%difference in apoptosis rates between PC3GnT-V/NC and PC3GnT-V/1079before radiation, and the difference was further amplified after radiation. Taken together, these data indicated that inhibition of GnT-V increased radiation-induced apoptosis in vitro.3.5. Inhibition of GnT-V increases radiation-induced caspase-3activityCaspase-3activity of PC3GnT-V/1079was higher than those of PC3and PC3GnT-V/NC at all three time points (24,48, and72h) following radiation (Table.5). It was confirmed that down-regulation of GnT-V might increase caspase-3activity, which was related with PC3radiation sensitivity.3.6. Inhibition of GnT-V decreases radiation-induced G2/M phase arrestG2/M phase cells in PC3GnT-V/NC and PC3GnT-V/1079were (15.49±0.84)%and (14.97±1.27)%before radiation by flow cytometer, however the difference between the two values had no statistical significance. A dose-dependent G2/M arrest was observed in PC3GnT-V/NC cells after radiation, while this phenomenon could not be observed in PC3GnT-V/1079cells.(Fig.6, Table.6) This finding suggests that down-regulation of GnT-V could result in decreased radiation-induced G2/M phase arrest.3.7. Inhibition of GnT-V enhances PC3radiation sensitivity in vivo. The growth of PC3GnT-V/1079tumors was significantly slowly compared with PC3tumors and PC3GnT-V/NC tumors (Figure7A-B). The mean tumor size were (429.93±13.05) mm3in PC3group,(419.00±16.53) mm3in PC3GnT-V/NC and (171.25±16.23) mm3in PC3GnT-V/1079following10Gy radiation (Table7,8).The PC3xenograft nude mice from PC3GnT-V/1079treated with radiation showed longer survival times than the control groups of PC3and PC3GnT-V/NC (Fig.8).Twenty-one days after radiation, mice were killed and tumors of the three groups were excised. Protein of tumors from PC3GnT-V/1079was decreased compared with PC3GnT-V/NC by western blot (Figure7C).3.8. Inhibition of GnT-V sensitizes cells to radiation-induced apoptosis via regulating expression of bcl-2family proteins in vitro and in vivo.The bax protein expression in PC3GnT-V/1079was higher than that in PC3and PC3GnT-V/NC whether before or after radiation by western blot. Furthermore, the expression of bax protein was increased in PC3GnT-V/1079after radiation compared with PC3GnT-V/1079before radiation. However, the expression of bax protein in PC3and PC3GnT-V/NC were unchanged before and after radiation. The results indicated that inhibition of GnT-V might induce expression of bax protein directly and radiation could result in the greater induction of bax protein.The expression of bcl-2protein in PC3GnT-V/1079was lower than PC3and PC3GnT-V/NC whether before or after radiation by western blot. Moreover, the expression of bcl-2protein was further decreased in PC3GnT-V/1079after radiation compared with PC3GnT-V/1079before radiation. However, the expression of bcl-2protein in PC3and PC3GnT-V/NC were increased after radiation compared with before radiation. The results indicated that radiation could increase bcl-2expression in PC3cell line, attenuation of GnT-V might inhibit radiation-induced bcl-2expression.No significant difference of bcl-xl protein was found between control groups and PC3GnT-V/1079by western blot. In addition, the bcl-xl protein remained unaltered in PC3, PC3GnT-V/NC, and PC3GnT-V/1079after radiation compared with before radiation. Suppression of GnT-V might have no effect on bcl-xl.Moreover, in vivo studies, the increased bax and decreased bcl-2in PC3GnT-V/1079after radiation can be confirmed by western blot and immunohistochemisty (Fig.9, Table.9).3.9. Correlations of GnT-V expression with clinicopathological factors in prostate cancer tissue.The association between GnT-V protein expression and histological grade was detected using tissue microarrays. Analysis of these tissue arrays showed that GnT-V expression was not found (0/5) in prostatic hyperplasia cases, but it was expressed in83cases of85prostate cancer samples. The "high GnT-V" expression was found in60%(12/20) of poor differentiated cases,23.9%(11/46) in moderate cases,10.5%(2/19) in well-differentiate cases. The "moderate GnT-V" expression rates were30%(6/20),54.3%(25/46), and15.8%(3/19) in poor, moderate, and well cases, respectively. Besides, the "low expression" for GnT-V was62.6%(12/19) in well differentiated cases,21.7%(10/46) in moderate cases, and10%(2/20) in poor cases (Table10). There were2negative cases in well-differentiated samples. A significantly increased expression of GnT-V in poorly and moderately differentiated cases was observed compared with that in well-differentiated cases, while expression of GnT-V was negative in prostatic hyperplasia.Besides, the correlation between GnT-V expression and TNM stage was also investigated. The25.9%(22/85) cases presented "high expression" for GnT-V, in which70.0%(7/10) in T4stage,25.0%(5/20) in T3stage,18.8%(9/48) in T2stage, and14.3%(1/7) inTl stage. The "moderate GnT-V" expression rates were14.3%(1/7),45.8%(22/48),65.0%(13/20) and20%(2/10) in Tl, T2, T3and T4, respectively. Besides, the "low expression" for GnT-V was42.9%(3/7) in T1,35.4%(17/48) in T2,10%(2/20) in T3and10%(1/10) in T4. The2negative cases of well-differentiated samples were observed in T1stage(Table11). These data indicated that the GnT-V expression positively correlated with TNM stage.Moreover, the correlation between GnT-V expression and Gleason score was also investigated. The32.9%(28/85) cases presented "high expression" for GnT-V, in which54.5%(18/33) in8-10score,24.3%(9/37) in5-7score,6.7%(1/15) in2-4score stage, The "moderate GnT-V" expression rates were13.3%(2/15),54.1%(20/37), and30.3%(10/33) in2-4score,5-7score and8-10score, respectively. Besides, the "low expression" for GnT-V was66.7%(10/15) in2-4score,21.6%(8/37) in5-7score,15.2%(5/33) in8-10score. The2negative cases of well-differentiated samples were observed in2-4score (Table12). These data indicated that the GnT-V expression positively correlated with Gleason score.Conclusion:1. The GnT-V expression positively correlated with clinicopathological factors in prostate carcinoma tissues.2. The shRNA expression vectors aimed at GnT-V gene can inhibit the expression of GnT-V both in the level of mRNA and protein obviously.3. Inhibition of GnT-V can enhance radiosensitivity of human prostate cancer cell Line PC3in vitro and in vivo.4. The potential mechanisms by which inhibition of GnT-V enhanced radiation sensitivity may be associated with suppression of bcl-2and up-regulation of Bax that ed to increased caspase-3activity.5. GnT-V may be a potential target for treatment of prostate cancer. |
PDF Full Text Request