The Mechanisms Of Regulation Of P2X7Receptor By Estrogen In Breast Cancer Cells

Estrogen is a kind of important steroid hormones in vivo, which has a major impact notonly on the female breast, ovary, uterus and other reproductive organs, but also on thecardiovascular, endocrine hormones or the skeletal system. Breast cancer is one of thecommon malignant tumors in the female. Studies have shown that increased estrogenlevels in vivo might raise the risk of breast cancer. The prevalence of breast cancer inpostmenopausal women is highly correlated with the estrogen level. More and moreresearchers attach importance to the molecular biology mechanism of estrogen in thedevelopment of breast cancer recently.Estrogen mainly exerts effect through the classic estrogen nuclear receptor. It can affect thetranscription and translation by activating nuclear estrogen receptor, also known asgenomic effect. ERα and ERβ belong to the ligand-activated nuclear receptor family oftranscription factors. After binding to the ligand binding domain, ESR dissociates from itsinhibitive proteins, undergoes a conformational change and dimerizes. These activatedESR-dimer complexes bind either directly, to specific estrogen response elements (EREs),or indirectly, to other transcription factors thus result in the recruitment of co-activatorproteins. ERα and ERβ play different roles in the process of tumor proliferation due totheir distinct structures.Recently it is found that estrogen has growth factor-like non-nuclear effect, also callednon-genomic. There are also ERs localized at or near the plasma membrane after exposureto ligand. G protein-coupled receptor-30(GPR30) is a novel membrane receptor ofestrogen. It can bind to estrogen specifically and rapidly activate intracellular epidermalgrowth factor-mitogen—activated protein kinase（EGFR-MAPK）, extracellular signal—regulated kinase（ERK）or phosphoinositide3-kinase—protein kinase A（PI3K-AKT）signaling pathways, involving in proliferation, invasion metastasis and drug resistance ofbreast cancer.The extracellular nucleotide receptors called P2receptors, including the P2X ligand-gatedion channels and P2Y G-protein coupled receptors. Seven subtypes of P2X receptors（P2X1-7）and eight subtypes of P2Y receptors （P2Y1,2,4,6,11-14）have been cloned. P2X7receptor exists in a wide range of human tissues and is overexpressed in breastcancer, prostate cancer and thyroid cancer. P2X7receptor can not only induce epidermalcells, cause the fusion of macrophages, stimulate cytokine release, but is also involved incell proliferation, differentiation and apoptosis by MAPK pathways. In addition, there isevidence that the P2X7receptor may mediate cell survival and growth by increasing theefficiency of oxidative phosphorylation and total intracellular ATP stores. It is shown thatP2receptor stimulation triggers from normal thyrocytes release of IL-6, which is acytokine with differentiating and growth-promoting effects in several endocrine glands.We previously detected that the expression of P2X3receptor in TG from OVX rats wassignificantly increased in mRNA and protein level. Estrogen replacement could decreasethe expression of P2X3receptor in both levels. Therefore,17β-estradiol might participatein the control of peripheral pain signal transduction by modulating P2X3receptor-mediated events in primary sensory neurons, probably through genomicmechanisms. These all suggest the possibility of regulation of P2X receptors by estrogen.Our previous work, preliminary demonstrat that estrogen upregulate the expression of theP2X7in the estrogen receptor-positive breast cancer cells.To further elucidate the possible mechanism and signaling pathways of estrogen, weinvestigated the effect of estrogen on P2X7receptor in the breast cancer cell lines MCF-7.It will provide new ideas and theoretical basis for the treatment of estrogen-dependenttumors such as ovarian cancer and endometrial cancer in the future work.1Experimental Material and Methods1.1Assessment of ProliferationThe MTT assays were conducted to assess cell proliferation. After incubation with drugs,cells seeded in96-well plates were harvested and pre-incubated with15μl MTT for3-4hrat37℃. Discarded culture media, added150μl DMSO, agitated cells on orbital shaker for5min. Read absorbance at490nm.1.2The Reverse Transcription-Polymerase Chain Reaction Analysis(1) RNAisolation and complementary DNATotal RNA was extracted using a RNeasy Mini Kit(QIAGEN; Clifton Hill, Australia). RNA purity was determined using a method of ultraviolet sepectrophotometry at awavelength of260-280nm.2μg of total RNA was reversely transcribed to complementaryDNA in a25μl reaction mixture containing1×reverse transcriptase buffer (15nmol MgCl2,375mmol KCl,50mmol DTT,250mmol Tris-HCl pH8.3),10mmol dNTP,20U RNaseinhibitor,200U mol-MLV reverse transcriptase, and50ng of oligo18primer. The reactiontime was at least1hr at42C. The cDNA was stored at-20C until real-time reversetranscriptase-polymerase chain reaction(RT-PCR) was performed.(2) Real-Time RT PCRThe following primers were used for PCR amplification: P2X7：AGATCGTGGAGAAT-GGAGTG（sense），TTCTCGTGGTGTAGTTGTGG (antisense), The PCR conditionswere95C for5min, followed by40cycles of95C for30sec,58C for25sec,72C30sec;β-actin GTGGGGCGCCCCAGGCACCA（sense），CTCCTTAATGTCACGCACGATTTC(antisense), The PCR conditions were95C for5min, followed by40cycles of95C for30sec,55C for25sec,72C30sec. The PCR solution consisted of1.2μl diluted cDNA,0.5mol of each paired primers,1.6mmol Mg2+，200mol dNTPs,2U Taq DNA polymerase,and1×PCR buffer.1.3Western BlotCells were harvested and homogenized in cold lysis buffer (50mmol/L Tris-HCl, pH7.4,150mmol/L NaCl,1%Triton X-100,1%Deoxycholic acidsodium salt,0.1%SDS,and a protease inhibitor mixture) using a homogenizer. Total protein concentrationwas determined by the Bradford method using bovine serum albumin as a standard.Proteins were separated using SDS-PAGE on10%TRIS-HCl gels and electrophoreticallytransferred to polyvinylidene difluoride membranes. The membranes were blocked inblocking buffer consisting of20mmol/L Tris-HCl, pH7.4,137mmol/L NaCl,0.1%Tween20, and5%nonfat milk at room temperature for2hr and then incubated with the rabbitprimary antibody overnight at4℃.The blots were washed, incubated with HRP-conjugatedsecondary antibody(1:1000)for2hr at room temperature, and finally visualized in ECLsolution. For control of correct gel loading, β-actin quantification was used. To quantifyWestern blot signals, band density was measured using UMAX PowerLook III andnormalized with respect to the control. 1.4siRNACells were transfected with25nmol/L target siRNAs or control siRNA using siPORTTMNeoFXTM Transfection Agent (Ambion) according to the manufacturer’s instructions, andtransfection was carried out for18hr or24hr. Subsequently, the culture medium wasreplaced with phenol red-deficient DMEM-Ham’s F-12medium supplemented with8%heat-inactivated FBS containing drugs. After48hr, MTT assays or Western blot analyseswere conducted to assess cell viability or P2X7protein expression.2Results2.1Estrogen could promote viability of MCF-7cells through ERα2.1.1The effect of estrogen and ER antagonist on promoting vaibility in MCF-7breast cancer cellsThe MTT result showed that proliferation of MCF-7cells were more than120%of controlafter48hr in different concentration of17β-E2(0.01nmol/L-1μmol/L) respectively. ERantagonist ICI182,780could block the effect of17β-E2.2.1.2ERα was involved in the cell process of estrogen promoting viability ofMCF-7cellsThe viability of MCF-7cells were more than120%of control after48hr in differentconcentration ER selective agonist PPT (0.01nmol/L-10μmol/L). This effect could beblocked by ER antagonist ICI182,780. The faciliation effect of17β-E2on MCF-7cellscould be blocked by the ERα antagonist MPP after96hr. Depletion of ER by siRNAcould block the promoting proliferation effect of17β-E2.2.1.3ERβ was not involved in the cell proliferation of MCF-7cells by estrogenThe faciliation effect of17β-E2on MCF-7cells could not be blocked by the ERβantagonist PHTPP. Depletion of ERβ could not block the effect of17β-E2.2.1.4The role of GPR30in faciliation effect on MCF-7cellsThe MTT result showed that different concentration GPR30receptor selective agonist G-1（0.1nmol/L-1μmol/L）exerted no effect on MCF-7cells after48hr application2.2P2X7receptor was involved in the process of estrogen promoting viability of MCF-7cells2.2.1The effect of P2X7receptor agonist and antagonist on estrogen promotingviability of MCF-7cellsThe MTT result showed that different concentration P2X7receptor agonist BzATP（10μmol/L-1mmol/L）had significant effect on proliferation in MCF-7cells. P2X7receptor antagonist PPADS could block not only the promoting effect of BzATP, but alsothe promoting effect of17β-E22.2.2Estrogen promoted expression of P2X7receptor via ERα in MCF-7cellsWestern blot result showed that the protein expression was increased in differentconcentration of17β-E2(0.1nmol/L-0.1mol/L) after24hr.Both P2X7receptor mRNAand protein were increased after17β-E2application. The effect of17β-E2could be blockedby ERα antagonist MPP. Down-regulation of ERα expression could block the increase ofP2X7protein by17β-E2.The protein expression of P2X7receptor was increased by ER agonist PPT. WhenMCF-7cells were pre-incubated with ER antagonist ICI182,780, the effect of PPT wasinhibited.2.2.3ERβ had no effect on P2X7expression in MCF-7breast cellsReal-time PCR showed that when MCF-7cells were pre-incubated with ERβ antagonistPHTPP, the expression of P2X7receptor mRNA could remain be increased by17β-E2.Western Blot showed that the protein expression was increased in the same trend asmRNA.ERβ agonist DPN (in different concentration of1nmol/L-10μmol/L) had no effect onprotein expression of P2X7after48hr application.2.2.4GPR30could not upregulate P2X7expression in MCF-7breast cellsWestern Blot showed that GPR30agonist (1μmol/L) had no effect on protein expression ofP2X7after4hr application.2.3The mechanism of estrogen promoting P2X7expresson in MCF-7cells2.3.1The effect of estrogen and ERα on ERK1/2phosphorylationBoth17β-E2（0.1μmol/L）and ER selective agonist PPT（0.1μmol/L）could up-regulate the p-ERK1/2protein level after15min or4hr application. The ER antagonist ICI182,780could block the upreguation of p-ERK1/2by17β-E2or PPT2.3.2The effect of estrogen and ERα on Akt phosphorylationWestern blot result showed that17β-E2and ER selective agonist PPT could increase thep-Akt protein after15min and4hr application and they were blocked by ER antagonist ICI182,780partly.2.3.3The effect of GPR30on ERK1/2orAkt phosphorylationGPR30selective agonist G-1(1μmol/L) could upregulate the ERK1/2and Akt phosphor-ylation after15min or4hr.2.3.4Estrogen might up-reugulate P2X7protein through ERK1/2or Akt singnalingpathways.ERK1/2antagonist U0126and Akt antagonist LY294002could block the up-regulaition ofP2X7protein by17β-E2.3、Conclusion（1）Estrogen promotes proliferation of MCF-7breast cells mainly mediated by ERα.（2）Estrogen promotes the proliferation of breast cancer cells by upregulating expressionof P2X7receptor mediated by ERα.（3）Estrogen may upregulate P2X7receptor expression through ERK1/2or Aktsingnaling pathways.In conclusion, estrogen might promote proliferation of breast cancer cells via activatingERα by upregulating P2X7expression and it may be related to ERK1/2or Akt singnalingpathways. It will provide new ideas and theoretical basis for the treatment ofestrogen-dependent tumors such as ovarian cancer and endometrial cancer in the futurework.